Review from last Tuesday: Who/ where do we get the DNA that is in our cells? __________________________ DNA is heritable material. What does heritable.

Slides:

Advertisements

Similar presentations

Forensic DNA Analysis (Part I)

Advertisements

DNA DNA. DNA is often called the blueprint of life. In simple terms, DNA contains the instructions for making proteins within the cell. Proteins control.

Traits & Environment Pp What are traits? Hair color Eye color HeightWeight Male vs. Female.

Leslie Follmar 2008 GENETICS c-notes. Leslie Follmar 2008 TRAITS Physical characteristics that an organism can pass off to offspring Examples: eye color.

Genetics Each cell in a human’s body contains 46 chromosomes:

Introduction to DNA and RNA Biology Standards B-4.1: Compare DNA and RNA in terms of structure, nucleotides, and base pairs. B-4.2: Summarize the relationship.

Genes, Chromosomes and DNA

DNA – Chromosomes - Genes. DNA DNA: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms. The material.

DNA. All living things contain a blueprint for the entire organism inside a special molecule known as _____. DNA stands for _____________________. A DNA.

What is DNA?  DNA is where the GENETIC CODE is stored.  It is a set of instructions for building proteins  Sent by the CEO to the WORKERS as instructions.

Deoxyribonucleic Acid DNA = What is DNA?  What is DNA used for in the cell?  DNA is where the GENETIC CODE is stored.  It is a set of instructions.

DNA, Chromosomes & Genes. GENOME The nucleus of a human cell contains between and genes. This complete set of genes is called the GENOME.

DNA, Chromosomes & Genes

Genetics – the study of heredity. At the end of this topic you should be able to 1. Discuss the variation and diversity of organisms 2. Define the term.

DNA DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms. Located in the nucleus, mitochondria and chloroplast.

Chapter 11 - DNa introduction. Forensics Uses DNA evidence has been used to investigate crimes, establish paternity, and identify victims of war and large-

The Structure of DNA All life on earth uses a chemical called DNA to carry its genetic code or blueprint. In this lesson we be examining the structure.

How Do Chromosomes Carry Information? Image courtesy of Dr. Sinnamon, Dean College of Arts and Sciences, Southern Wesleyan University.

DNA DNA is often called the blueprint of life.

1 2 DNA DNA.DNA is often called the blueprint of life. In simple terms, DNA contains the instructions for making proteins within the cell.

1. Let’s Review! What is a macromolecule? What are the four kinds of organic molecules? What are nucleic acids made of? 2 - A large organic molecule (made.

DNA. What is DNA? DNA is found in all living cells – It controls all functions inside a cell – It stores all the genetic information for an entire living.

Deoxyribonucleic Acid Structure and Function

1 2 DNA DNA.DNA is the blueprint of life. DNA contains the instructions for making proteins.

DNA: the blueprint of life. Where do you get your DNA? DNA is passed from parent to offspring. Where do we find DNA? DNA is in the nucleus of every cell.

A gene is a particular sequence (a string) of nucleotides on a particular site of a chromosome. It is made up of combinations of A, T, C, and G. These.

1DNA DNA.DNA is often called the blueprint of life. That is because DNA contains the instructions for making proteins. And proteins determine the traits.

DNA Replication & Protein Synthesis Designed by Mr. Gaccione.

Genetic/Hereditary Material (DNA)

How Do Chromosomes Carry Information? Image courtesy of Dr. Sinnamon, Dean College of Arts and Sciences, Southern Wesleyan University.

Genetics. Why do offspring look like their parents? Parents pass half of their DNA to their offspring Heredity (Inheritance) - The passing of traits from.

Genetics DNA and Chromosomes. DNA Deoxyribonucleic Acid –D–Double Helix Shape –(–(Twisted Ladder) Genetic code – –I–Instruction manual.

DNA, RNA & Genetics Notes

Date EntryPage # 1/8 Genetic Terms5 1/13 Traits Lab6 1/13 Where is DNA?7 1/13 Tour of Basics8.

REVIEW – Back of books 1. Name 3 differences between sexual and asexual reproduction. 2. Give 2 examples of asexual reproduction. 3. What is a variation?

BIOLOGY 12 Introduction to Genetics. “If our strands of DNA were stretched out in a line, the 46 chromosomes making up the human genome would extend more.

1. Where in the cell is DNA found? In the nucleus.

Nucleotide Nucleic Acid DNA

Overview DNA stands for d Deoxyribose Nucleic Acid Thinking Points What is the structure of DNA? Why is DNA so important?

__________ = passing on of characteristics from parents to offspring How?... _____ HEREDITY DNA!

Chromosomes, DNA, and Genes EQ: Can I describe the relationship among genes, chromosomes, and inherited traits?

CHROMOSOMES & DNA REPLICATION DNA WHERE IS DNA FOUND IN THE CELL? IN PROKARYOTIC CELLS, DNA IS LOCATED IN THE CYTOPLASM. MOST PROKARYOTES HAVE.

Cornell Notes. Essential Questions (Eqs) 1) What is DNA? 2) What is the function and importance of DNA for all organisms? 3) What is the basic structure.

From DNA to Proteins Section 2.3 BC Science Probe 9 Pages

Modern Genetics How information is passed from parents to offspring.

Year 10, Pathway C DNA  DNA is made up of phosphates, sugars and nitrogen bases.  A binds with T  C binds with G and.

You are what you eat!.  Deoxyribonucleic Acid  Long, double-stranded chain of nucleotides  Contains genetic code  Instructions for making the proteins.

Let’s see what you know! 23,000, microscope, nucleus, chromosomes, divide, DNA, proteins, code, genes __________.

DNA Molecular basis of heredity How much DNA is in my body?  DNA is found in every cell (except red blood cells)  Each cell contains roughly 2 meters.

Genetic Information How are chromosomes, genes and DNA related? What are their roles as repositories or “keepers & transmitters” of genetic information?

DNA Deoxyribonucleic Acid. DNA Review Genetic material (DNA) is found in the nucleus of cells, and is contained on chromosomes. An organism inherits chromosomes.

DNA: Structure DNA: Structure Biology 12 DNA Facts: Each cell has about 2 m of DNA. The average human has 75 trillion cells. The average human has enough.

DNA Blueprint of life. DNA - DEOXYRIBONUCLEIC ACID.

What does DNA have to do with PROTEINS?

The Structure of DNA Where is the DNA in these pictures?

Cells, Chromosomes, DNA and RNA

The molecule of heredity

GENETICS (Geneology) the study of “genes” Inheritable traits that

The genetic material of our bodies.

The Structure of DNA All life on earth uses a chemical called DNA to carry its genetic code or blueprint. In this lesson we be examining the structure.

DNA: Structure Biology 12.

B-4.2 Summarize the relationship among DNA, genes, and chromosomes.

Inherited Trait: Example: The ability to roll your tongue upwards is an inherited trait. An inherited trait is a characteristic passed from the male and.

Introduction to DNA 1. Why do Biologists call DNA “the genetic blueprint for life”? 1a. DNA contains all the information an organism needs to make all.

DNA, Chromosomes & Genes

CHAPTER 11 GENETICS Genetics is the study of how traits or characteristics are inherited. Inherited characteristics are controlled by genes and are passed.

Notes – Genetics 1.

Presentation transcript:

Review from last Tuesday: Who/ where do we get the DNA that is in our cells? __________________________ DNA is heritable material. What does heritable mean? ________________________ DNA is made up of repeating ___________________________. Each nucleotide contains a ___________________, __________________, and nitrogenous ________. Figure 1 is a single nucleotide. Label the sugar, phosphate, and the base. What are the 4 different types of nucleotides and which bases pair with each other? _____________________________________________________ _

Review from last Tuesday: 1.DNA is inherited FROM OUR PARENTS. 1.Heritable = can be passed on to offspring 1.DNA is made up of repeating nucleotides. Each nucleotide contains a sugar, phosphate, and nitrogenous base.

4. Figure 1 is a single nucleotide. Label the sugar, phosphate, and the base. 5. The 4 bases are A, T, G, C. A only pairs with T. G pairs with C. PHOSPHATE RIBOSE BASE

ONE NUCLEOTIDE

ALL living organisms are made of CELLS. The “control center” of a cell is called the NUCLEUS. The nucleus contains DNA, which gives instructions for how a living organism can function.

AGTAGTCCTAGATCGGCGTTGAAG This DNA is broken up into sections called GENES. Each gene codes for a SPECIFIC PRODUCT, such as a protein for HAIR color, EYE color, or BLOOD cells. GENE SPECIFIC PRODUCT

BUT our cells are microscopic, yet our DNA has 3 MILLION base pairs, which would stretch out to 9 FEET

DID YOU KNOW? If the... length of the 100 trillion cells could be stretched out, it would be... over 113 billion miles [182 billion kilometres]. That is enough material to reach to the sun and back 610 times 610 TIMES!

DID YOU KNOW? The U.S. Department of Energy Human Genome Project Information Web site illustrates the size of the human genome by estimating that it would take "about 9.5 years to read out loud (without stopping) the more than three billion pairs of bases in one person's genome sequence"

SO.....HOW DO WE FIT ALL OF THIS DNA IN OUR CELLS

DNA is tightly wound into CHROMOSOMES. Therefore, each chromosome contains DIFFERENT genes.

CELLS NUCLEUS DNA CHROMOSOMES GENES

Label this diagram with Cell, Nucleus, Chromosomes, DNA, gene

NUCLEUS CELLCHROMOSOMES DNA GENE

GUIDED PRACTICE WITH A PARTNER (15 minutes)