A New Look at the Major Features of Evolution Stevan J. Arnold Department of Integrative Biology Oregon State University.

Slides:

Advertisements

Similar presentations

The Elephant in the Dark:

Advertisements

The Ecology of Adaptive Radiation. QUICK Think of the First Adaptive Radiation That Comes to Mind.

Phenotypic evolution: the emergence of a new synthesis Stevan J. Arnold Oregon State University.

Simulation Studies of G-matrix Stability and Evolution Stevan J. Arnold (Oregon State Univ.) Adam G. Jones (Texas A&M Univ.) Reinhard Bürger (Univ. Vienna)

Summer Bioinformatics Workshop 2008 Comparative Genomics and Phylogenetics Chi-Cheng Lin, Ph.D., Professor Department of Computer Science Winona State.

1 Apply Concepts To an evolutionary taxonomist, what determines whether two species are in the same genius 2 Explain What is a derived character 3 Review.

Molecular Clock I. Evolutionary rate Xuhua Xia

Resolving the paradox of stasis: models with stabilizing selection explain evolutionary divergence on all timescales Suzanne Estes & Stevan J. Arnold.

Genetica per Scienze Naturali a.a prof S. Presciuttini Human and chimpanzee genomes The human and chimpanzee genomes—with their 5-million-year history.

The Challenge of Scale: Is Biodiversity Big Science? Woody Turner Biodiversity & Ecological Forecasting Team Meeting University of Maryland May 1, 2008.

Data talking to theory, theory talking to data: how can we make the connections? Stevan J. Arnold Oregon State University Corvallis, OR.

The Emperor’s New Clothes: Biomedical Research and the Social Construction of Race Summer Public Health Videoconference on Minority Health, June 18 th.

Invasive Species Grant Mulligan. Outline Invasive Birds Invasive Plants Climate Change.

Vogelwarte.ch BIO 232 Macroecology, niche evolution and climate change by Niklaus. E. Zimmermann Today: Damaris Zurell.

EVOLUTION ALONG SELECTIVE LINES OF LEAST RESISTANCE* Stevan J. Arnold Oregon State University *ppt available on Arnold’s website.

Systematics The study of biological diversity in an evolutionary context.

1 General Introduction and Characterization of the Marine Brown Algae: Part I Notes by Naomi Phillips Arcadia University Edited by Suzanne Fredericq University.

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

RATES OF DIVERSIFICATION. BACKGROUND Rapid rate of diversification often follows the adaptive radiation + (sexual) selection New niches Mutation New species.

BNFO 602/691 Biological Sequence Analysis Mark Reimers, VIPBG

Evolution Diversity of Life.

Evolution II - contents Macroevolution and Microevolution Phylogenetic trees and cladistics Examples of convergent evolution How to identify cases of convergent.

How Does Evolution Work? Individual organisms cannot evolve. Populations of a particular species evolve. Natural selection acts on the range of phenotypes.

Nick Isaac, Tom August & Gary Powney Trends in British Biodiversity since

Macroevolutionary patterns and the fossil record Diversity changes Rates of evolutionary change Patterns of lineage diversification.

100 years of living science Andy Purvis Ecology & Evolution section Division of Biology Phylogeny and biodiversity in a changing.

The Origin of Species Chapter 24 BCOR 012 Jan. 31 and Feb. 2, 2011.

Reductionism & the Modern Synthesis “Change in allele frequency over time” Wright Dobzhansky Stebbins Fisher Simpson Haldane.

Lecture 18: Rates of Evolutionary Change G. G. Simpson: “Tempo & Mode in Evolution” (1944) applied principles of modern synthesis (e.g. population genetics)

1.2 Inheritance of a Single Trait & Response to Selection Stevan J. Arnold Department of Integrative Biology Oregon State University.

Part of AS Relates to US What is EVOLUTION ? Evolution is change over time - Change means heritable change in a population Time means over.

Extinction 2: Conservation and extinction risk Brian O’Meara EEB464 Fall 2015 ABC News.

Quantifying uncertainty in species discovery with approximate Bayesian computation (ABC): single samples and recent radiations Mike HickersonUniversity.

Department of philosophy and history of science

2.2 Selection on a Single & Multiple Traits Stevan J. Arnold Department of Integrative Biology Oregon State University.

Genetics and Speciation

Identifying conserved segments in rearranged and divergent genomes Bob Mau, Aaron Darling, Nicole T. Perna Presented by Aaron Darling.

2.2 Selection on a Single & Multiple Traits Stevan J. Arnold Department of Integrative Biology Oregon State University.

History by Shalise and Conner. Machu Picchu Machu Picchu is in Peru and was discovered (by the western world )in the year 1911, however indigenous peoples.

Can the Fisher-Lande Process Account for Birds-of-Paradise and Other Sexual Radiations? Stevan J. Arnold & Lynne D. Houck Department of Integrative Biology.

Introduction to History of Life. Biological evolution consists of change in the hereditary characteristics of groups of organisms over the course of generations.

3.1 Selection as a Surface Stevan J. Arnold Department of Integrative Biology Oregon State University.

Developmental Constraints, Genetic Correlations & Natural Selection.

Form, function & fitness— Antagonist J. Brad Johnson 1,2, D. Brent Burt 1, Thomas J. DeWitt 2 1 Dept. Biology, Stephen F. Austin State University 2 Dept.

Question: How heritable is a sexually-selected plumage color trait? Background: To see an evolutionary response to selection, a trait must be heritable.

Phylogenetics: The “E” word in disguise Keith A. Crandall, Brigham Young University

Chapter12 : Processes of Evolution

3.2 Evolution on Adaptive Landscapes Stevan J. Arnold Department of Integrative Biology Oregon State University.

Page 1 Model interoperations: Community models, models as services, and model webs NASA Biodiversity and Ecological Forecasting Team Meeting New York 8.

2.1 Multivariate Inheritance & Response to Selection Stevan J. Arnold Department of Integrative Biology Oregon State University.

Comparative methods wrap-up and “key innovations”.

A high-resolution map of human evolutionary constraints using 29 mammals Kerstin Lindblad-Toh et al Presentation by Robert Lewis and Kaylee Wells.

The Theory of Evolution.  Darwin developed the first theory on evolution, which is the basis for modern evolutionary theory ◦ Darwin spent 5 years sailing.

17.3 Darwin and Natural Selection: What Darwin knew  Darwin understood the fossil record and explained it by combining the two popular ideas of gradualism.

The Origin of Species What is a Species? Modes of Speciation Origin of Evolutionary Novelty.

Abundance Trends and Fisheries for Highly Migratory Species

CHAPTER 14 The Origin of Species

The Evolution and Speciation of Plasmodium spp. Among Primates

Evolution and Spread of Ebola Virus in Liberia, 2014–2015

The Nature of Mammalian Species

Chapter 24 – The Origin of Species

WPV1 complete VP1 gene phylogeny including the RC2010 viruses.

Epigraph for today’s Symposium:

Blaine D. Ebberts Presented at the NPCC Science to Policy Exchange

Michael G. Klein et al. JACEP 2016;j.jacep

Patterns of Evolution 9/20/13.

Global effect of tree species diversity on forest productivity.

Fig. 1 Example of diversified propagation patterns of the MJO.

Presentation transcript:

A New Look at the Major Features of Evolution Stevan J. Arnold Department of Integrative Biology Oregon State University

Outline Criteria for the conservation of individual species G. L. Simpson’s modes of evolution Evolution of body size: data Evolution of body size: models The concept of quantum evolution The concept illustrated with African birds A new criterion for the conservation

Criteria for conservation Threatened status Ecological importance (e.g., keystone species) Useful to humans Charisma (e.g., flagship species) Uniqueness (e.g., aardvark)

Simpson’s two evolutionary modes: phyletic evolution and quantum evolution Simpson 1944

Simpson’s concept of quantum evolution Simpson 1944

Modern version of quantum evolution Lande 1976

Uyeda et al. 2011

±65% change in body size Uyeda et al. 2011

“The Blunderbuss Pattern” Uyeda et al. 2011

The multiple-burst model: a process that produces quantum evolution (peak movement, evolution of the lineage mean) Uyeda et al A single lineage Time (generations) Lineage mean

Burst timing distribution (mean time between bursts = 25 my) White noise distribution (dashed) Burst size distribution (solid) Probability Divergence B C A Interval (years) The model that best fits the data has two modes: phyletic & quantum Uyeda et al. 2011

Can we detect quantum evolution in the birds of Central Africa?

Provisos Phylogeny ignored Exclusive focus on body size Measure of body size includes tail Focus on Central Africa ignores relatives elsewhere

No quantum evolution

Quantum evolution of Great Blue Turaco

Quantum evolution of ground hornbills

Quantum evolution of the Giant Kingfisher

Criteria for conservation Threatened status Ecological importance (e.g., keystone species) Useful to humans Charisma (e.g., flagship species) Uniqueness (e.g., aardvark) Replacement time (e.g., ≧ 25 million years for a ground hornbill)

Conclusions To account for evolutionary pattern in a large data set we need a model with two modes: phyletic and quantum. Quantum evolutionary events can lead to rapid, substantial evolution but they are rare, with an average waiting time of 25 million years. Some families of birds in Central Africa appear to have experienced quantum evolution (e.g., hornbills, kingfishers, and turacos).

References Simpson, G. L Tempo and Mode in Evolution. Columbia Univ. Press. Simpson, G. L The Major Features of Evolution. Columbia Univ. Press. Lande, R Uyeda, J., T. Hansen, S. J. Arnold, J. Pienaar The million-year wait for evolutionary bursts. Proceedings of the National Academy of Science. U.S.A. Arnold, S. J Phenotypic evolution, the ongoing synthesis. American Naturlist Van Perlo, Ber Birds of Western and Central Africa. Princeton Univ. Press.

Acknowledgements PhD advisor: Arnold Kluge Research collaborators: Suzanne Estes, Josef Uyeda, Thomas Hansen, Jason Pienaar Data: Phil Gingerich, Andrew Hendry, Michael Kinnison NSF OPUS program: Mark Courtney