Abstract ODE System Model of GRNs Summary Evolving Small GRNs with a Top-Down Approach Javier Garcia-Bernardo* and Margaret J. Eppstein Department of Computer.

Slides:



Advertisements
Similar presentations
Michael R. Smith, Mark Clement, Tony Martinez, and Quinn Snell
Advertisements

The story beyond Artificial Immune Systems Zhou Ji, Ph.D. Center for Computational Biology and Bioinformatics Columbia University Wuhan, China 2009.
Model Checking Genetic Regulatory Networks with Parameter Uncertainty Grégory Batt, Calin Belta, Ron Weiss HSCC 2007 Presented by Spring Berman ESE :
Goal Show the modeling process used by both Collins (toggle switch) and Elowitz (repressilator) to inform design of biological network necessary to encode.
On the Genetic Evolution of a Perfect Tic-Tac-Toe Strategy
Experiments We measured the times(s) and number of expanded nodes to previous heuristic using BFBnB. Dynamic Programming Intuition. All DAGs must have.
Graduate Center/City University of New York University of Helsinki FINDING OPTIMAL BAYESIAN NETWORK STRUCTURES WITH CONSTRAINTS LEARNED FROM DATA Xiannian.
Biologically Inspired AI (mostly GAs). Some Examples of Biologically Inspired Computation Neural networks Evolutionary computation (e.g., genetic algorithms)
Cyanobacterial Oscillator in E. coli Why care about biological oscillators in the first place? Bio-oscillators have a number of potential applications:
Prénom Nom Document Analysis: Artificial Neural Networks Prof. Rolf Ingold, University of Fribourg Master course, spring semester 2008.
A Heuristic Bidding Strategy for Multiple Heterogeneous Auctions Patricia Anthony & Nicholas R. Jennings Dept. of Electronics and Computer Science University.
Deterministic and Stochastic Analysis of Simple Genetic Networks Adiel Loinger MS.c Thesis of under the supervision of Ofer Biham.
Deterministic and Stochastic Analysis of Simple Genetic Networks Adiel Loinger Ofer Biham Azi Lipshtat Nathalie Q. Balaban.
Modularity in Biological networks.  Hypothesis: Biological function are carried by discrete functional modules.  Hartwell, L.-H., Hopfield, J. J., Leibler,
UNIVERSITY OF JYVÄSKYLÄ Topology Management in Unstructured P2P Networks Using Neural Networks Presentation for IEEE Congress on Evolutionary Computing.
Prénom Nom Document Analysis: Artificial Neural Networks Prof. Rolf Ingold, University of Fribourg Master course, spring semester 2008.
Adiel Loinger Ofer Biham Nathalie Q. Balaban Azi Lipshtat
Evolutionary Algorithms Simon M. Lucas. The basic idea Initialise a random population of individuals repeat { evaluate select vary (e.g. mutate or crossover)
Discovery of RNA Structural Elements Using Evolutionary Computation Authors: G. Fogel, V. Porto, D. Weekes, D. Fogel, R. Griffey, J. McNeil, E. Lesnik,
An Application of Bendixson-Boincare Theorem MAT 574- Fall 2003 Arizona State University Math & Stat Dept.
Artificial Intelligence Genetic Algorithms and Applications of Genetic Algorithms in Compilers Prasad A. Kulkarni.
Introduction to molecular networks Sushmita Roy BMI/CS 576 Nov 6 th, 2014.
Network analysis and applications Sushmita Roy BMI/CS 576 Dec 2 nd, 2014.
Genetic Programming. Agenda What is Genetic Programming? Background/History. Why Genetic Programming? How Genetic Principles are Applied. Examples of.
Image Registration of Very Large Images via Genetic Programming Sarit Chicotay Omid E. David Nathan S. Netanyahu CVPR ‘14 Workshop on Registration of Very.
By Paul Cottrell, BSc, MBA, ABD. Author Complexity Science, Behavioral Finance, Dynamic Hedging, Financial Statistics, Chaos Theory Proprietary Trader.
Prepared by Barış GÖKÇE 1.  Search Methods  Evolutionary Algorithms (EA)  Characteristics of EAs  Genetic Programming (GP)  Evolutionary Programming.
Demetris Kennes. Contents Aims Method(The Model) Genetic Component Cellular Component Evolution Test and results Conclusion Questions?
Genetic Algorithm.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
1 Evolutionary Growth of Genomes for the Development and Replication of Multi-Cellular Organisms with Indirect Encodings Stefano Nichele and Gunnar Tufte.
A Comparison of Nature Inspired Intelligent Optimization Methods in Aerial Spray Deposition Management Lei Wu Master’s Thesis Artificial Intelligence Center.
Artificial Intelligence
CS 484 – Artificial Intelligence1 Announcements Lab 3 due Tuesday, November 6 Homework 6 due Tuesday, November 6 Lab 4 due Thursday, November 8 Current.
Genetic Algorithms Michael J. Watts
What is Genetic Programming? Genetic programming is a model of programming which uses the ideas (and some of the terminology) of biological evolution to.
Predictive Design Space Exploration Using Genetically Programmed Response Surfaces Henry Cook Department of Electrical Engineering and Computer Science.
Analysis of the yeast transcriptional regulatory network.
Neural and Evolutionary Computing - Lecture 9 1 Evolutionary Neural Networks Design  Motivation  Evolutionary training  Evolutionary design of the architecture.
Bioinformatics Multiple Alignment. Overview Introduction Multiple Alignments Global multiple alignment –Introduction –Scoring –Algorithms.
Systems Biology ___ Toward System-level Understanding of Biological Systems Hou-Haifeng.
Steady-state Analysis of Gene Regulatory Networks via G-networks Intelligent Systems & Networks Group Dept. Electrical and Electronic Engineering Haseong.
Engineered Gene Circuits Jeff Hasty. How do we predict cellular behavior from the genome? Sequence data gives us the components, now how do we understand.
Improving the Genetic Algorithm Performance in Aerial Spray Deposition Management University of Georgia L. Wu, W.D. Potter, K. Rasheed USDA Forest Service.
IMPROVED RECONSTRUCTION OF IN SILICO GENE REGULATORY NETWORKS BY INTEGRATING KNOCKOUT AND PERTURBATION DATA Yip, K. Y., Alexander, R. P., Yan, K. K., &
The Cognate interaction Genomic arrays A new era for modeling the immune response Benoit Morel.
Biologically inspired algorithms BY: Andy Garrett YE Ziyu.
De novo discovery of mutated driver pathways in cancer Discussion leader: Matthew Bernstein Scribe: Kun-Chieh Wang Computational Network Biology BMI 826/Computer.
Direct and specific chemical control of eukaryotic translation with a synthetic RNA-protein interaction Stephen J. Goldfless, Brian A. Belmont, Alexandra.
Learning Chaotic Dynamics from Time Series Data A Recurrent Support Vector Machine Approach Vinay Varadan.
Nonlinear differential equation model for quantification of transcriptional regulation applied to microarray data of Saccharomyces cerevisiae Vu, T. T.,
Evolutionary Robotics The Genotype-to-Phenotype Map The genotype to phenotype map: the algorithm that transforms the genotype into the phenotype. Direct.
A comparative approach for gene network inference using time-series gene expression data Guillaume Bourque* and David Sankoff *Centre de Recherches Mathématiques,
Ferdinando A. Mussa-Ivaldi, “Modular features of motor control and learning,” Current opinion in Neurobiology, Vol. 9, 1999, pp The focus on complex.
Sporadic model building for efficiency enhancement of the hierarchical BOA Genetic Programming and Evolvable Machines (2008) 9: Martin Pelikan, Kumara.
Organic Evolution and Problem Solving Je-Gun Joung.
Selection and Recombination Temi avanzati di Intelligenza Artificiale - Lecture 4 Prof. Vincenzo Cutello Department of Mathematics and Computer Science.
Computational methods for inferring cellular networks II Stat 877 Apr 17 th, 2014 Sushmita Roy.
1 Artificial Regulatory Network Evolution Yolanda Sanchez-Dehesa 1, Loïc Cerf 1, José-Maria Peña 2, Jean-François Boulicaut 1 and Guillaume Beslon 1 1.
Multi-cellular paradigm The molecular level can support self- replication (and self- repair). But we also need cells that can be designed to fit the specific.
Directed Evolution of a Genetic Circuit 15 February 2008 George McArthur This presentation is primarily based on content taken from the paper “Directed.
An Evolutionary Algorithm for Neural Network Learning using Direct Encoding Paul Batchis Department of Computer Science Rutgers University.
Genetic Algorithm. Outline Motivation Genetic algorithms An illustrative example Hypothesis space search.
Selected Topics in CI I Genetic Programming Dr. Widodo Budiharto 2014.
Optimization Based Design of Robust Synthetic
1 Department of Engineering, 2 Department of Mathematics,
1 Department of Engineering, 2 Department of Mathematics,
1 Department of Engineering, 2 Department of Mathematics,
The use of Neural Networks to schedule flow-shop with dynamic job arrival ‘A Multi-Neural Network Learning for lot Sizing and Sequencing on a Flow-Shop’
Multidisciplinary Optimization
Presentation transcript:

Abstract ODE System Model of GRNs Summary Evolving Small GRNs with a Top-Down Approach Javier Garcia-Bernardo* and Margaret J. Eppstein Department of Computer Science and Vermont Complex Systems Center University of Vermont * Being able to design genetic regulatory networks (GRNs) to achieve a desired cellular function is one of the main goals of synthetic biology 1. While several researchers have used evolutionary algorithms to evolve network motifs or synthetic networks with a desired behavior 2,3, previous studies have rarely evolved minimal or near-minimal GRNs. Even when methods were explicitly designed to try to prune excess parts 4,5, the number of interactions in the evolving GRNs increased over generations. In this paper, we use a top-down approach, where we start with relatively dense GRNs and use differential evolution 6 (DE) to evolve interaction coefficients. When the target dynamical behavior is found embedded in a dense GRN, we narrow the focus of the search and attempt to remove excess interactions. Three methods were tested to encourage parsimonious networks. We first show that the method can quickly rediscover known small GRNs for a toggle switch and an oscillatory circuit. Next we include these known small GRNs as non-evolvable subnetworks in the subsequent evolution of more complex, modular GRNs. By incorporating aggressive pruning after the desired behavior was found, along with a dynamic penalty term, the DE was able to evolve minimal, or nearly minimal, GRNs in all 4 test problems. ) Hierarchical Evolution of GRNs We first validated the method by evolving GRNs for two known circuits: (a) Bistable, a simple toggle switch, and (b) Oscillator, an oscillatory circuit. We then included those known GRNs as non-evolvable subnetworks in the subsequent evolution of two more complex, modular GRNs: (c) ConditionalOscillator, in which we evolved indirect interactions between non-evolvable subnetworks for a toggle switch and an oscillatory circuit, and (d) DualOscillator, which combined two mutually exclusive oscillators; to make this problem more difficult we only included one copy of a non-evolvable oscillatory circuit. Results (out of 25 repetitions each) In summary, we present a top-down, evolutionary approach that can be recursively applied to hierarchically evolve increasingly complex, modular GRNs with few, if any, excess interactions. While our primary motivation is for designing GRNs for synthetic biology, the algorithm introduced in this work could be used for the inference of naturally-occurring GRNs from gene expression data. Additionally, our approach could be used for evolving parsimonious topologies for Artificial Neural Networks. Method Dynamic penalty for # and strength of interactions: Discard weak interactions: if |n i,j | < 0.5, set |n i,j |= 0. Aggressive Pruning (see below) ForcedReductionyesnoyes NoPenaltynoyesno WithPenaltyyes no Aggressive Pruning Encouraging Evolution of Minimal GRNs DE was used to evolve the parameters K i,j and n j,i of up to 6 genes (up to 84 decision variables). Once a desired behavior was found, the DE strategy was shifted from DE/rand/1/bin to DE/rand-to-best/1/bin, to focus the search. DE was combined with three approaches designed to encourage parsimonious networks, as follows: The ForcedReduction method is able to relatively quickly evolve minimal or near-minimal genetic networks with the desired behaviors. The other two methods also succeed in evolving the desired behaviors, but the resulting GRNs have many excess interactions. References In aggressive pruning, at the end of each DE generation subsequent to the strategy shift, for each solution that exhibited the desired dynamics, we iterated through each Hill coefficient n j,i, testing raw fitness (before penalty) with n j,i = 0. If fitness degraded by 10% or less, we kept n j,i = 0. This process was continued until we had replaced five coefficients with zero or we ran out of Hill coefficients to try. ForcedReduction Penalty NoPenalty 1 A.S. Khalil and J.J. Collins, “Synthetic Biology: applications come of age”, Nature Reviews Genetics, 5: , P. François and V. Hakim, “Design of genetic networks with specified functions by evolution in silico”, PNAS, 101:580–585, N. Noman, L. Palafox, and H. Iba, “Evolving Genetic Networks for Synthetic Biology”, New Gener. Comput., vol. 31, no. 2, pp. 71–88, B. Drennan and R. Beer, “Evolution of repressilators using a biologically-motivated model of gene expression”, ALIFE X, pp. 22–27, M. Dorp, B. Lannoo, and E. Carlon, “Evolutionary Generation of Small Oscillating Genetic Networks”, in Adaptive and Natural Computing Algorithms, pp. 120–129, R. Storn and K. Price, “Differential Evolution – A Simple and Efficient Heuristic for global Optimization over Continuous Spaces”, J. Glob. Optim., 11:341–359, Small GRNs evolved by the ForcedReduction method. Representative run for the evolution of the DualOscillatory network. For each pair of genes i and j, the coefficients K i,j and n j,i determine the strength of the positive or negative regulatory interaction of the protein coded for by gene j on the expression of gene i. Positive n j,i indicates a negative regulation of the gene i by the protein j, and vice versa; n j,i = 0 means no interaction exists. DNA gene i bound with regulatory proteins p j mRNA m i transcription translation Protein p i regulation Remove 1 interaction if fitness not degraded > 10% for up to 5 interactions removed each generation Initially dense networks Final networks very sparse In ForcedReduction, the number of interactions grows until the desired behavior is found, then excess interactions are removed. Despite more fitness evaluations per generation, this method converges with fewer total fitness evaluations.