Hooray! First, a Video!. 2 Nucleic Acids 3 DNA!  Frederick Griffith in 1928 showed the DNA was the cell’s genetic material  Watson & Crick in the 1950’s.

Slides:



Advertisements
Similar presentations
RNA AND PROTEIN SYNTHESIS
Advertisements

copyright cmassengale
Dr. Maha Daghestani DNA structure and function Dr. Maha Daghestani November 2007.
Protein Synthesis Jessica Hawley.
PROTEIN SYNTHESIS.
Review 1. Base Pairing Rule Watson and Crick showed that DNA is a double helixWatson and Crick showed that DNA is a double helix A (adenine) pairs with.
PROTEIN SYNTHESIS.
Nucleic Acids.
RNA.
Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.
Protein Synthesis Human Biology. DNA Deoxyribonucleic Acid Twisted ladder or double helix Nucleotides Composed of alternating sugar (Deoxyribose) and.
copyright cmassengale
PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.
RNA & Protein Synthesis.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA.
1 PROTEIN SYNTHESIS. DNA and Genes 2 Genes & Proteins DNA contains genes, sequences of nucleotide bases These genes code for polypeptides (proteins)
1 PROTEIN SYNTHESIS copyright cmassengale. 2 Protein Synthesis DNA ‘s code must be copied and taken to the ribosomes.DNA ‘s code must be copied and taken.
PROTEIN SYNTHESIS.
RNA and Protein Synthesis. Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by copying part of.
PROTEIN SYNTHESIS.
RNA AND PROTEIN SYNTHESIS
1 DNA, RNA, and PROTEIN SYNTHESIS. 2 Transcription Translation DNA mRNA Ribosome Protein Prokaryotic Cell DNA  RNA  Protein.
1 PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for proteins Proteins are used to build cells.
1 PROTEIN SYNTHESIS copyright cmassengale. DNA and Genes 2copyright cmassengale.
1 DNA  RNA  Protein DNA  mRNA  Protein Nuclear membrane Transcription Translation DNA mRNA Ribosome Protein Eukaryotic Cell.
PROTEIN SYNTHESIS 1. DNA AND GENES DNA ■ DNA contains genes, sequences of nucleotide bases ■ Genes have different alleles. ■ These genes code for polypeptides.
DNA Structure & Replication DNA DNA.DNA is often called the blueprint of life. In simple terms, DNA contains the instructions for making proteins.
copyright cmassengale
Protein Synthesis: Making Those Proteins!. Review: DNA Hershey and Chase’s experiment showed that DNA was the genetic material.
copyright cmassengale
1 PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.
Write the complementary strand: 5’ T G A C A G C T T C 3’
Jessica Hawley PROTEIN SYNTHESIS.  Identify and compare DNA and RNA.  Explain the three types of RNA.  Demonstrate understanding using codon and anticodon.
PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.
Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.
1 The Central Dogma of Biology PROTEIN SYNTHESIS.
PROTEIN SYNTHESIS copyright cmassengale1. Starting with DNA DNA is the molecule that stores genetic information in the nucleus.DNA is the molecule that.
PROTEIN SYNTHESIS. Review: DNA contains genes or a set of instructions. These genes code for a certain sequence of amino acids, that form polypeptides,
1. Transcription and Translation 2copyright cmassengale.
1 Nucleic Acids 2 Structure of DNA  made of monomers called nucleotides  nucleotides composed of a phosphate, deoxyribose sugar, and a nitrogen-containing.
RNA AND PROTEIN SYNTHESIS. Central Dogma of Biology! Genes are codes for making polypeptides (proteins) The nitrogenous bases (ATCG’s) contain the code!
 James Watson and Francis Crick worked out the three-dimensional structure of DNA, based on work by Rosalind Franklin Figure 10.3A, B.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA.
1 PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.
RNA AND PROTEIN SYNTHESIS. How your cell makes very important proteins proteinsThe production (synthesis) of proteins. 2 phases2 phases: 1.Transcription.
DNA replication and Protein synthesis.. DNA (Deoxyribonucleic Acid)
1copyright cmassengale. RNA 2 3 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan copyright cmassengale.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA.
copyright cmassengale
PROTEIN SYNTHESIS.
PROTEIN SYNTHESIS.
PROTEIN SYNTHESIS.
Nucleic Acids.
RNA AND PROTEIN SYNTHESIS
PROTEIN SYNTHESIS.
PROTEIN SYNTHESIS.
RNA AND PROTEIN SYNTHESIS
PROTEIN SYNTHESIS.
PROTEIN SYNTHESIS.
copyright cmassengale
copyright cmassengale
RNA AND PROTEIN SYNTHESIS How does protein synthesis occur?
GENE EXPRESSION / PROTEIN SYNTHESIS
copyright cmassengale
RNA AND PROTEIN SYNTHESIS How does protein synthesis occur?
PROTEIN SYNTHESIS.
Presentation transcript:

Hooray! First, a Video!

2 Nucleic Acids

3 DNA!  Frederick Griffith in 1928 showed the DNA was the cell’s genetic material  Watson & Crick in the 1950’s built the 1 st model of DNA

4 Structure of DNA  DNA is made of subunits called nucleotides  DNA nucleotides are composed of a phosphate, deoxyribose sugar, and a nitrogen-containing base  The 4 bases in DNA are: adenine (A), thymine (T), guanine (G), and cytosine (C)

5 DNA Nucleotide

6 Base Pairing Rule Watson and Crick showed that DNA is a double helixWatson and Crick showed that DNA is a double helix A (adenine) pairs with T (thymine)A (adenine) pairs with T (thymine) C (cytosine) pairs with G (guanine)C (cytosine) pairs with G (guanine)

7 DNA or Protein?  Walter Sutton discovered chromosomes were made of DNA and Protein  However, scientists were NOT sure which one (protein or DNA) was the actual genetic material of the cell

END DAY 1 8

9 PROTEIN SYNTHESIS

10 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA must be processed before it leaves the nucleus of eukaryotic cells

11 Transcription Translation DNA mRNA Ribosome Protein Prokaryotic Cell DNA  RNA  Protein

12 DNA  RNA  Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

13 Pathway to Making a Protein DNAmRNA tRNA (ribosomes) Protein

14 RNA

15 RNA Differs from DNA 1.RNA has a sugar ribose DNA has a sugar deoxyribose 2.RNA contains the base uracil (U) DNA has thymine (T) 3.RNA molecule is single-stranded DNA is double-stranded

16 Structure of RNA

17. Three Types of RNA Messenger RNA (mRNA) carries genetic information to the ribosomesMessenger RNA (mRNA) carries genetic information to the ribosomes Ribosomal RNA (rRNA), along with protein, makes up the ribosomesRibosomal RNA (rRNA), along with protein, makes up the ribosomes Transfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesizedTransfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesized

18 Making a Protein

19 Genes & Proteins  Proteins are made of amino acids linked together by peptide bonds  20 different amino acids exist  Amino acids chains are called polypeptides  Segment of DNA that codes for the amino acid sequence in a protein are called genes

20 Two Parts of Protein Synthesis  Transcription makes an RNA molecule complementary to a portion of DNA  Translation occurs when the sequence of bases of mRNA DIRECTS the sequence of amino acids in a polypeptide

21 Genetic Code  DNA contains a triplet code  Every three bases on DNA stands for ONE amino acid  Each three-letter unit on mRNA is called a codon  Most amino acids have more than one codon!  There are 20 amino acids with a possible 64 different triplets  The code is nearly universal among living organisms

22

23 Transcription Translation

END DAY 2 24

25 Overview of Transcription  During transcription in the nucleus, a segment of DNA unwinds and unzips, and the DNA serves as a template for mRNA formation  RNA polymerase joins the RNA nucleotides so that the codons in mRNA are complementary to the triplet code in DNA

26 Steps in Transcription  The transfer of information in the nucleus from a DNA molecule to an RNA molecule  Only 1 DNA strand serves as the template  Starts at promoter DNA (TATA box)  Ends at terminator DNA (stop)  When complete, pre-RNA molecule is released

27 Transcription

28

29 What is the enzyme responsible for the production of the mRNA molecule?

30 RNA Polymerase  Enzyme found in the nucleus  Separates the two DNA strands by breaking the hydrogen bonds between the bases  Then moves along one of the DNA strands and links RNA nucleotides together

31 DNApre-mRNA RNA Polymerase

32 Question:  What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’

33 Answer: DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’RNA 3’-CGCAUAC-5’

DAY 3

35 Processing Pre-mRNA Also occurs in the nucleusAlso occurs in the nucleus Pre-mRNA made up of segments called introns & exonsPre-mRNA made up of segments called introns & exons Exons code for proteins, while introns do NOT!Exons code for proteins, while introns do NOT! Introns spliced out by splicesome- enzyme and exons re-joinIntrons spliced out by splicesome- enzyme and exons re-join End product is a mature RNA molecule that leaves the nucleus to the cytoplasmEnd product is a mature RNA molecule that leaves the nucleus to the cytoplasm

36 RNA Processing pre-RNA molecule intron exon Mature RNA molecule exon intron splicesome

37 Messenger RNA (mRNA) Carries the information for a specific proteinCarries the information for a specific protein Made up of 500 to 1000 nucleotides longMade up of 500 to 1000 nucleotides long Sequence of 3 bases called codonSequence of 3 bases called codon AUG – methionine or start codonAUG – methionine or start codon UAA, UAG, or UGA – stop codonsUAA, UAG, or UGA – stop codons

38 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

39 Transfer RNA (tRNA) Made up of 75 to 80 nucleotides longMade up of 75 to 80 nucleotides long Picks up the appropriate amino acid floating in the cytoplasmPicks up the appropriate amino acid floating in the cytoplasm Transports amino acids to the mRNATransports amino acids to the mRNA Have anticodons that are complementary to mRNA codonsHave anticodons that are complementary to mRNA codons Recognizes the appropriate codons on the mRNA and bonds to them with H-bondsRecognizes the appropriate codons on the mRNA and bonds to them with H-bonds

40 Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid

41 Ribosomal RNA (rRNA) Made up of rRNA is 100 to 3000 nucleotides longMade up of rRNA is 100 to 3000 nucleotides long Made inside the nucleus of a cellMade inside the nucleus of a cell Associates with proteins to form ribosomesAssociates with proteins to form ribosomes

42 Ribosomes Made of a large and small subunit Composed of rRNA (40%) and proteins (60%) Have two sites for tRNA attachment --- P and A

43 Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

44 Translation Synthesis of proteins in the cytoplasmSynthesis of proteins in the cytoplasm Involves the following:Involves the following: 1.mRNA (codons) 2.tRNA (anticodons) 3.ribosomes 4.amino acids

45 Translation Three steps:Three steps: 1.initiation: start codon (AUG) 2.elongation: amino acids linked 3.termination: stop codon (UAG, UAA, or UGA). Let’s Make a Protein !

Video Hooray!

47 mRNA Codons Join the Ribosome P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

48 Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

49 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

50 mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

51 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

52 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

53 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

54 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

55 mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

56 End Product –The Protein! The end products of protein synthesis is a primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bondsA sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199

57