Relate the concept of the gene to the sequence of nucleotides in DNA. CH. 12.3 : DNA, RNA, and Protein Section Objectives: Relate the concept of the gene to the sequence of nucleotides in DNA. Sequence the steps involved in protein synthesis. Explain the different types of RNA involved in protein synthesis

Genes and Proteins The sequence of nucleotides in DNA contain information. This information is put to work through the production of proteins. Proteins fold into complex, three- dimensional shapes to become key cell structures and regulators of cell functions. Thus, by encoding the instructions for making proteins, DNA controls cells.

Genes and Proteins You learned earlier that proteins are polymers of amino acids. The sequence of nucleotides in each gene contains information for assembling the string of amino acids that make up a single protein.

DNA  Proteins  Cells  Bodies DNA has the information to build proteins genes proteins cells DNA gets all the glory, Proteins do all the work bodies

Cell organization DNA DNA is in the nucleus genes = instructions for making proteins want to keep it there = protected “locked in the vault” cytoplasm nucleus

Cell organization Proteins chains of amino acids made by a “protein factory” in cytoplasm protein factory = ribosome cytoplasm nucleus build proteins ribosome

Passing on DNA information: need RNA RNA like DNA, is a nucleic acid RNA structure differs from DNA structure in three ways. 1. Has ribose sugar instead of deoxyribose (DNA) 2. Replaces thymine (T) with uracil (U) 3. Single stranded as opposed to double stranded DNA Nitrogenous base (A, G, C, or U) Phosphate group Uracil (U) Sugar (ribose)

RNA RNA has a different function than DNA Whereas DNA provides the instructions for protein synthesis, RNA does the actual work of protein synthesis. RNAs take from DNA the instructions on how the protein should be assembled, then—amino acid by amino acid—RNAs assemble the protein.

RNA 3 types of RNA 1. Messenger RNA (mRNA), single, uncoiled strand which brings instructions from DNA in the nucleus to the site of protein synthesis. 2. Ribosomal RNA (rRNA), globular form, makes up the ribosome –the construction site of proteins binds (site of protein synthesis); binds to the mRNA and uses the instructions to assemble the amino acids in the correct order. 3. Transfer RNA (tRNA) single, folded strand that delivers the proper amino acid to the site at the right time

Passing on DNA information Need to get DNA gene information from nucleus to cytoplasm need a copy of DNA messenger RNA cytoplasm nucleus build proteins mRNA ribosome

Protein Synthesis: 2 step process 1. Transcription 2. translation 1.Transcription: DNA -> mRNA In the nucleus, enzymes make an RNA copy of a portion of a DNA strand The main difference between transcription and DNA replication is that transcription results in the formation of one single-stranded RNA molecule rather than a double-stranded DNA molecule. 2. Translation: mRNA -> Protein process of converting the information in a sequence of nitrogenous bases in mRNA into a sequence of amino acids in protein

From nucleus to cytoplasm transcription DNA mRNA protein translation trait nucleus cytoplasm

Transcription Making mRNA from DNA DNA strand is the template (pattern) match bases U : A G : C Enzyme RNA polymerase

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ribosome U C A G

RNA Processing Not all the nucleotides in the DNA of eukaryotic cells carry instructions—or code—for making proteins. Genes usually contain many long noncoding nucleotide sequences, called introns, that are scattered among the coding sequences. Regions that contain information are called exons because they are expressed. When mRNA is transcribed from DNA, both introns and exons are copied. The introns must be removed from the mRNA before it can function to make a protein. Enzymes in the nucleus cut out the intron segments and paste the mRNA back together. The mRNA then leaves the nucleus and travels to the ribosome.

RNA Processing:simplified Noncoding segments called introns are spliced out ( coding segment = exons)

Genetic information written in codons is translated into amino acid sequences Transfer of DNA to mRNA uses “language” of nucleotides Letters: nitrogen bases of nucleotides (A,T,G,C) Words: codons ~triplets of bases ( ex. AGC) Sentences: polypeptide chain The codons in a gene specify the amino acid sequence of a polypeptide

The Genetic Code The nucleotide sequence transcribed from DNA to a strand of messenger RNA acts as a genetic message, the complete information for the building of a protein.. Virtually all organisms share the same genetic code

Translation: From mRNA to Protein takes place at the ribosomes in the cytoplasm. Involves 3 types of RNA 1. Messenger RNA (mRNA) =carries the blueprint for construction of a protein 2. Ribosomal RNA (rRNA) = the construction site where the protein is made 3. Transfer RNA (tRNA) = the truck delivering the proper amino acid to the site at the right time

Transfer RNA molecules serve as interpreters during translation In the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptide The process is aided by transfer RNAs Each tRNA molecule has a triplet anticodon on one end and an amino acid attachment site on the other Anticodon base pairs with codon of mRNA

cytoplasm protein nucleus ribosome U C A G trait

How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA How? mRNA U C A G aa

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon ribosome AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein Codon = block of 3 mRNA bases

The Genetic code For ALL life! Code has duplicates Start codon strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid Anti-codon = block of 3 tRNA bases

mRNA to protein = Translation The working instructions  mRNA The reader  ribosome The transporter  transfer RNA (tRNA) ribosome mRNA U C A G aa tRNA G U aa tRNA U A C aa tRNA G A C tRNA aa A G U

From gene to protein DNA mRNA protein trait tRNA transcription aa transcription translation DNA mRNA protein ribosome U C A G tRNA aa trait nucleus cytoplasm

cytoplasm protein transcription translation nucleus trait

From gene to protein protein transcription translation