Today’s Plan: 9/10/09 Bellwork: Portfolio updates (10 mins) Quiz Corrections (20 mins) DNA Modeling (45 mins) Notes (10 of activities) Pack/Wrap up (last 5 mins)

Today’s Plan: 9/11/09 Bellwork: Vocabulary quiz (30 mins) –If you finish early, review the answers to the questions on the overhead Finish DNA Structure, DNA Replication and RNA Activities Replication/RNA/Transcription Notes Pack/Wrap-up (last few mins of class)

Today’s Plan: 9/14/09 Bellwork: DNA and Replication Quiz (15 mins) When you finish your quiz, copy down the chart from the overhead and begin filling it in. Go over quiz (10 mins) Transcription activity (20 mins) Transcription/Translation Notes (30 mins) Pack/Wrap-up (last few mins of class)

Today’s Plan: 915/09 Bellwork: DNA Drills/Chart Practice (20 mins) Protein Synthesis activity (30 mins) Mutation Exercise (30 mins) Pack/Wrap-up (last few mins of class)

DNA structure Composed of nucleotides (see overhead) Nucleotides consist of: –phosphate –sugar (deoxyribose) –Nitrogenous base Adenine Thymine Guanine Cytosine (A only bonds w/T, and G w/C)

Hierarchy of Genetics Genome (all of the chromosomes a person has) –Chromosomes Chromatid –Chromatin »Genetic code »Gene »Codon »(this gets progressively smaller as you move down the hierarchy)

Replication Defined as the reproduction of an identical copy of DNA. Mediated by enzymes –Helicase-breaks hydrogen bonds in DNA –Topoisomerase-un-twists and twists DNA –DNA Polymerase-Enzyme which holds DNA open and allows new nucleotides to bond with it –Ligase-Links any “holes” in the non-contiunous DNA strand Involves unzipping the DNA strand and filling in nucleotides to bond w/the open strand See overhead and draw pictures

RNA Structure Composed of nucleotides-similar to DNA –phosphate –sugar (ribose) –Nitrogenous bases Adenine Uracil (in place of Thymine) Guanine Cytosine Single-stranded molecule (unlike DNA) see overhead for pictures

Transcription Like replication, takes place in the nucleus Makes RNA. Question-Why does the DNA send RNA to carry info and not go itself? Is used to make RNA from specific genes only (not the whole DNA strand) Starts at the gene’s promoter site (beginning of the gene) and ends at the termination site (end of the gene) involves the DNA unzipping at the site of that gene, and RNA nucleotides filling in (mediated by RNA polymerase)

Types of RNA Messenger (mRNA)-carries information from the DNA (it is complimentary to DNA) in the nucleus to the ribosome where proteins are made (this is said to be the blueprint for the proteins) Transfer (tRNA)-is complimentary to the mRNA, and carries amino acids to the ribosome to be assembled into proteins Ribosomal (rRNA)-is globular in shape and joins to structural proteins to make ribosomes

Translation mRNA moves to the Ribosome, which holds it so that the tRNA can attach, bringing amino acids close together. The amino acids can then bond to form the protein chain. See overheads and draw pictures

Genetic Code and Genes Genetic Code consists of all of the bases of DNA (the backbone is only there for structure) Genes consist of all of the codons that encode for a specific protein (chain of amino acids) b/c of gene overlap, start and stop codons are necessary

Mutation Exercise Given this Strand: ATGTTACCGAGATTCTTGTTTTAG, transcribe and translate the message. Now, change the Strand to: ATGTTACCGAGAATCTTGTTTTAG, find the mutation and find the message. Now, change the strand to: ATGTTCACGAGATTCTTGTTTTAG, find the mutation and find the message. Now, change the Strand to: ATGTTACGAGAATCTTGTTTTAG, find the mutation and find the message.

Mutation Point-where one base is changed. Frame-shift-where one base is deleted Inversion-where 2 bases switch places Any can occur at various places. Where can you think of? What processes may account for mutation?

Regulating Genes Mostly, transcription takes place when a particular protein is needed Sometimes, organisms have genes with built-in on/off switches In Prokaryotes (bacteria), there is an Operon system (lac operon is an example) –Promoter is where the enzymes that do transcription attach to the DNA –Operator is the regulation site (on/off switch) where the Repressor molecule binds to turn off the operator –The genes of the operon follow the operator site –When lactose is present, it binds to the repressor, making it change shape, so it no longer fits the operator any more and the gene is on In Eukaryotes, there are operons, but in stead of containing multiple genes, they only contain 1 gene

Figure 17-7a Repressor present, lactose absent: Repressor synthesized DNA lacl + RNA polymerase bound to promoter (blue DNA) lacZ lacY Repressor binds to DNA. No transcription occurs. Normal lacl gene The repressor blocks transcription

Figure 17-7b Repressor present, lactose present: TRANSCRIPTION BEGINS  -Galactosidase Permease mRNA lacZ lacY RNA polymerase bound to promoter (blue DNA) Lactose-repressor complex Repressor synthesized Lactose binds to repressor, causing it to release from DNA. Transcription occurs (lactose acts as inducer). Normal lacl gene lacl +