Thomas D. Kocher Department of Biology BSCI 338K - Lecture 3 Developmental genetics of sex determination.

Slides:



Advertisements
Similar presentations
Genetic Analysis of Genome-wide Variation in Human Gene Expression Morley M. et al. Nature 2004,430: Yen-Yi Ho.
Advertisements

Tianyu Zhan, Sharon Huang, Nallammai Muthiah, Evangeline Giannopoulos, J Peter Gergen Stony Brook University, Department of Biochemistry and Cell Biology.
KEY CONCEPT Genes can be mapped to specific locations on chromosomes.
Lesson Aims You will see examples of the main ways by which features are inherited. You will record an example of each inheritance pattern including a.
I. Allelic, Genic, and Environmental Interactions
Two copies of each autosomal gene affect phenotype.
KEY CONCEPT Phenotype is affected by many different factors.
KEY CONCEPT A combination of methods is used to study human genetics.
Thomas D. Kocher Department of Biology Genetic Basis of Sexual Conflict in Lake Malawi Cichlid Fishes.
Systems Biology Biological Sequence Analysis
Positional Cloning LOD Sib pairs Chromosome Region Association Study Genetics Genomics Physical Mapping/ Sequencing Candidate Gene Selection/ Polymorphism.
Developmental Genetics, I.How do different cell types become organized into tissues, organs & systems? II.Sex determination in Drosophila III.Sex determination.
Sex Linked Traits Humans have 23 pairs of chromosomes.
The Hunt for Chromosomal Determinants of Maleness— A gene mapping story……. The Hunt for Chromosomal Determinants of Maleness— A gene mapping story…….
SRY Gene on Chromosome Y Jon Scales Genetics Fall GTAACAAAGAATCTGGTAGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCA 61 CCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATG.
Committee Meeting April 24 th 2014 Characterizing epigenetic variation in the Pacific oyster (Crassostrea gigas) Claire Olson School of Aquatic and Fishery.
Characterizing the role of miRNAs within gene regulatory networks using integrative genomics techniques Min Wenwen
Introduction to BST775: Statistical Methods for Genetic Analysis I Course master: Degui Zhi, Ph.D. Assistant professor Section on Statistical Genetics.
SEX DETERMINATION & SEX-LINKED INHERITANCE. SEX DETERMINATION l The greatest difference between individual members of the same species is their sex.
Sex Determination and Sex-Linked Traits
Genetics and Inheritance Year 10 Biology Part 1: Genes & Chromosomes.
Jeopardy Genes and Chromosomes Basics
CS177 Lecture 10 SNPs and Human Genetic Variation
Sex Chromosomes.
KEY CONCEPT A combination of methods is used to study human genetics.
Experimental Design and Data Structure Supplement to Lecture 8 Fall
9 Genes, chromosomes and patterns of inheritance.
Genetics: Karyotypes and Sex-linked traits March , 2010.
1 Chapter 13 –Is Sex Necessary? Well, is it??. 2 The Benefits of Sex A novel assortment of genes Starting with meiosis, cell fusion, the diploid state,
Thomas D. Kocher Department of Biology BSCI 338K Pigmentation Projects.
Human Genetics Chapter 12
Chapter 12.5 Sex Determination in Humans AP Biology Fall 2010.
What is a QTL? Quantitative trait locus (loci) Region of chromosome that contributes to variation in a quantitative trait Generally used to study “complex.
Genes that are located on the sex chromosomes are sex-linked genes. In mammals, individuals with two X chromosomes, an XX genotype, are females. Individuals.
Aim #51: How do organisms create offspring through sexual reproduction?
KEY CONCEPT A combination of methods is used to study human genetics.
November 12, 2009 Mrs. Bracken Please Begin Your Daily “Mind Matters” BIOLOGY.
Chap 6 notes Human Inheritance. Karyotype Shows all 46 human chromosomes 23 pairs Chromosomes 1-22 are autosomes (regular chromosomes) The last set of.
7.4 Human Genetics and Pedigrees TEKS 6F, 6H The student is expected to: 6F predict possible outcomes of various genetic combinations such as monohybrid.
Developmental genetics: The intersection of genetics, birth defects and functional genomics n Many human birth defects are due to impairment of developmental.
7.1 Chromosomes and Phenotype KEY CONCEPT The chromosomes on which genes are located can affect the expression of traits.
Inheritance Patterns and Human Genetics
Date: February 28th, 2017 Aim # 53: How do organisms create offspring through sexual reproduction? ? HW: Daily Review of Class Notes Worksheet- Diploid.
Complexity of gene expression
EQTLs.
KEY CONCEPT A combination of methods is used to study human genetics.
KEY CONCEPT A combination of methods is used to study human genetics.
Genetics: Karyotypes and X-linked traits
KEY CONCEPT A combination of methods is used to study human genetics.
Jeopardy Genes and Chromosomes
KEY CONCEPT A combination of methods is used to study human genetics.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT A combination of methods is used to study human genetics.
Sex Chromosomes.
Lecture 9 Genome Mapping By Ms. Shumaila Azam
KEY CONCEPT A combination of methods is used to study human genetics.
KEY CONCEPT A combination of methods is used to study human genetics.
KEY CONCEPT A combination of methods is used to study human genetics.
EDEXCEL GCSE BIOLOGY GENETICS Part 2
How do organisms create offspring through sexual reproduction?
Determining Sex.
John D. Rioux, Valerie A. Stone, Mark J
Beyond Mendel Matters of Sex Types of Tests
Imprinted chromosomal regions of the human genome display sex-specific meiotic recombination frequencies  Andràs Pàldi, Gàbor Gyapay, Jacques Jami  Current.
Human Genetics and Pedigrees
KEY CONCEPT A combination of methods is used to study human genetics.
KEY CONCEPT A combination of methods is used to study human genetics.
KEY CONCEPT A combination of methods is used to study human genetics.
KEY CONCEPT A combination of methods is used to study human genetics.
Expression patterns for teleost-specific whole-genome duplication duplicates of the androgen receptor−signaling pathway in four Lake Tanganyika cichlids,
Presentation transcript:

Thomas D. Kocher Department of Biology BSCI 338K - Lecture 3 Developmental genetics of sex determination

Migration of Primordial Germ Cell (PGCs)

Functional gene network analysis of testis development genes 109 genes with 1.5-fold change in expression from e13-e16 in the mouse gonad. Cell processes involved in testis development were determined based on the number of arrows connected to each box (connectivity). (Clement et al. 2007)

Genetic interactions

Developmental pathway

Central switch? (DiNapoli and Capel, 2007)

Vertebrate sex determination Ezaz et al SRY

Tilapia (Genomar)

Sex-linked markers in Oreochromis niloticus: LG1 (Lee 2003) Ph.D thesis of Bo-Young Lee

Epistasis in O. aureus LG 1 LG 3 X/XX/Y W/Z Z/Z (Lee 2004)

LG1 and LG3 are distinct chromosomes (Cnaani 2007)

Sex-linked markers in tilapia

Sex determination in Malawi cichlids Survey of 19 species in five genera 94 families (2066 offspring) Extensive variation in sex ratios Genotyped for microsatellite markers Focused on LG 5 and 7 M.S. thesis of Jennifer Ser

Metriaclima phaeos - XY on LG7

Metriaclima phaeos - WZ on LG5

M. fainzilberi - WZ and XY

Grand summary…

Hidden complexity of genetic interactions LG7 XY (widespread) LG5 WZ (OB species) LG? XY M. kompakt LG? M. callainos LG? WZ M. lombardoi LG? WZ M. pyrsonotus

Metriaclima lombardoi 44 chromosomes + B chromosome (some females) Duplication in largest pair (some males) Irani Ferreira

Sex determiners in African cichlids Tilapia Malawi

Candidate gene on LG1

Ijiri et al. 2006

Quantitative PCR of mRNA Ijiri et al. 2006Tilapia gonads 0-70 days

Project Opportunities: Sex Determination Fine map the LG1 XY locus in Nile tilapia Fine map the LG7 XY locus in Malawi cichlids Map new sex determiners in Malawi cichlids Map sex determiners in Lake Victoria cichlids Map sex determining locus in Astatotilapia burtoni Annotate sex determining regions of other fishes onto cichlid genome sequence Characterize expression of candidate genes during gonad development

Proposal Process Proposal format –Cover page –Abstract (300 words) –Proposal Body (10 pp total) Background (2-3 pp) Preliminary data (1-2 pp) Proposed research (5-6 pp) Expected Results and timeline (1 pp) –References –Budget Proposals due ****Feb 17, 2011 **** Peer reviews due Feb 22, 2011 Panel meeting Feb 24, 2011 Project start date March 1, 2011

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.