Structure-activity relationships of some alkylated iminosugars Nikolay Kukushkin, St.-Petersburg State University.

Slides:

Advertisements

Similar presentations

ESSENTIALS OF GLYCOBIOLOGY LECTURE 14 DEGRADATION AND TURNOVER OF GLYCOCONJUGATES Hud Freeze.

Advertisements

Protein sorting and the Golgi apparatus

Essentials of Glycobiology Lecture 5 April 6, 2004 Ajit Varki N-Glycans Asparagine (N)-linked oligosaccharides N-linked Glycans N-linked Sugar Chains.

Golgi complex László KŐHIDAI, PhD., Assoc. Prof. Department of Genetics, Cell- and Immunobiology Semmelweis University 2008.

Development of High-throughput Screening Assay for Small Molecule Inhibitor(s) of PIAS1 Bourns College of Engineering Department of Bioengineering Vicente.

Antibody Activity Against Sialidase Used as a Potential Therapeutic Treatment for Autoimmune Disorders Amber Williams, Department of Biology, York College.

Lorna Pierce. To generate free oligosaccharides characteristic of protein misfolding due to treatment with NB-DNJ To observe the effect of endomannosidase.

Inhibition of Ganglioside Biosynthesis by Imino Sugars Reduces Binding of Guillain-Barré Syndrome Autoantibodies. Rhea McGarry Glycobiology Department.

The synthesis and biological characterisation of novel  -glucosidase inhibitors Amy Rawling Balliol College.

Iminosugars as Antivirals Against Cytopathic and non Cytopathic Bovine Viral Diarrhea Virus Mark Hussey Dr Zitzmann Prof Dwek.

Background: a bit about… Important roles in: Glycoprotein biosynthesis, quality control & catabolism Multiple forms of α-mannosidases in mammalian cells,

Elevated Levels of Cholesterol Metabolites in NPC Phenotype Cells Daniel Witter Scripps/ Oxford Lab Glycobiology Institute Oxford University.

Imino sugars and perturbation of protein folding pathways in the ER Dom Alonzi.

Developing an in vitro cellular model for Fabry Disease Part II Project Emma Brewer

Glycoconjugate storage & pathogenesis in an in vitro cellular model of Sandhoff disease Stephanie Boomkamp.

Part II project by Katherine Warre-Cornish

Restricted distribution of Isoglobotrihexosylceramide (iGb3) - Implications for natural endogenous NKT cell selecting and activating ligand(s) Annie Speak.

The development of a robust method for labelling glycans & its practical application. Glycobiology Institute University of Oxford.

Free oligosaccharides as biological markers of endoplasmic reticulum-associated degradation and the role of endomannosidase. I admit that the title of.

ESSENTIALS OF GLYCOBIOLOGY

Analysis of N-linked Glycoprotein misfolding Derek Wan Christ Church.

The Lysosome and lysosomal storage disorders (LSD) Part III A Clinical profile of the LSDs Serge Melançon, MD February 2009.

1 Cell death induced by the phenolic antioxidant tert-butylhydroquinone and its metabolite tert-butylquinone in human monocytic leukemia U937 cells Okubo.

Isosteviol derivatives induced apoptosis in Human lung cancer via targeting MEK/MAPK pathway: An in vitro and in vivo study Ahmed M Malki 1,,PhD Stephen.

The Biological Activity of a Novel Photoaffinity- Labelled Imino Sugar Jane Atkin St. Hilda’s College.

Post-Translational Events II ER & Golgi Processes.

Functional interactions between calmodulin and estrogen receptor-α

Principles of Metabolic Regulation: Glucose and Glycogen Part 1 Chapter 15.

From liposomes to proteomes: Investigating the cellular effects of virus and drugs Sally Latham Candidate MScRes.

Effect of High Concentrations of Diesel Exhaust Particles on Human Lung Epithelial Cell Viability and Death Hasan Bayram 1*, Kazuhiro Ito 2, K. Fan Chung.

GS-9350: A Pharmacoenhancer Without anti-HIV Activity AA Mathias, P German, M Lee, C Callebaut, L Xu, L Tsai, B Murray, H Liu, K Yale, D Warren and BP.

Journal Club A Novel N-Tetrasaccharide in Patients with Congenital Disorders of Glycosylation Including Asparagine-Linked Glycosylation Protein 1, Phosphomannomutase.

1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.

Gene regulation Lecture No 5: Protein folding and Ubiquitination

Conference on RER, Golgi, and secretion

Functional Glycobiology Structure of Glycoconjugates sugar residues, linkage, sequence, conformation types of glycoconjugate, protein and lipid Biosynthesis.

Speaker: Kacy Richmond Advisor: Dr. Jun Ren (School of Pharmacy)

Metformin prevents glucotoxicity by alleviating oxidative and ER stress–induced CD36 expression in pancreatic beta cells Jun Sung Moon, Udayakumar Karunakaran,

Cell Physiol Biochem 2013;32: DOI: /

Sphingolipids and Myelin Structure

Dr. Robert Grier, Fayetteville State University

Juan F. Mejia, Parker Hall, Kelsey M. Hirschi, Paul R

IL-1β stimulates CXCL5 and CXCL8 gene expression and protein secretion in A549 cells in a time- and dose-dependent manner. IL-1β stimulates CXCL5 and CXCL8.

Antidiabetic Effect of Salvianolic Acid A on Diabetic Animal Models via AMPK Activation and Mitochondrial Regulation Cell Physiol Biochem 2015;36:

Volume 98, Issue 1, Pages (July 1999)

BIOLOGY, Faculty of Dentistry

Volume 14, Issue 4, Pages (October 2011)

Robert Earl Routh, John Hardwick Johnson, Kevin John McCarthy

SPHINGOLIPIDS AND MYELIN STRUCTURE. OUTLINES Objectives. Background. Key principles. Take home messages.

Biofilm Inhibitors that Target Amyloid Proteins

Volume 155, Issue 4, Pages (October 2018)

More Than One Glycan Is Needed for ER Glucosidase II to Allow Entry of Glycoproteins into the Calnexin/Calreticulin Cycle Paola Deprez, Matthias Gautschi,

Pharmacological Chaperone Therapy: Preclinical Development, Clinical Translation, and Prospects for the Treatment of Lysosomal Storage Disorders Giancarlo.

Volume 57, Issue 2, Pages (October 2000)

Retinoid Signaling by all-trans Retinoic Acid and all-trans Retinoyl-β-D-Glucuronide Is Attenuated by Simultaneous Exposure of Human Keratinocytes to.

Volume 88, Issue 1, Pages (January 1997)

Glycoprotein degradation: Do sugars hold the key?

Molecular Therapy - Methods & Clinical Development

Supplemental Figure 2 RPMI8226 cells were incubated with increasing concentrations of the respective HIV PI (0-160 mM; Am: amprenavir; At: atazanavir;

Ca2+ Influx through Distinct Routes Controls Exocytosis and Endocytosis at Drosophila Presynaptic Terminals Hiroshi Kuromi, Atsuko Honda, Yoshiaki Kidokoro

Volume 62, Issue 2, Pages (August 2002)

Ho Jae Han, Soo Hyun Park, Hyun Ju Koh, Mary Taub Kidney International

Sphingolipids and Myelin Structure

André Zapun, Claude A Jakob, David Y Thomas, John JM Bergeron

Sphingolipids and Myelin Structure

PNA-Encoded Protease Substrate Microarrays

Effect of a Fusion Peptide by Covalent Conjugation of a Mitochondrial Cell-Penetrating Peptide and a Glutathione Analog Peptide Carmine Pasquale Cerrato,

IGF-1 regulation of type II collagen and MMP-13 expression in rat endplate chondrocytes via distinct signaling pathways M. Zhang, Ph.D., Q. Zhou, M.D.,

Metabolic profiling and characterization of reliance on de novo lipid synthesis of prostate cell lines. Metabolic profiling and characterization of reliance.

Presentation transcript:

Structure-activity relationships of some alkylated iminosugars Nikolay Kukushkin, St.-Petersburg State University

Iminosugar Ceramide-specific glucosyltransferase α -glucosidases I & II Glucose NB-DNJ

Ceramide-specific glucosyltransferase Biosynthesis Catabolism GSL pool Treatment of glycosphingolipid (GSL) storage diseases

Ceramide-specific glucosyltransferase Key enzyme in GSL biosynthesis Key enzyme in GSL biosynthesis

Unfolded proteinMisfolded protein α-glucosidases I & II Unfolded protein Glucose Mannose N-acetylglucosamine α-glucosidase Calnexin/calreticulincycle ERAD Potential antiviral strategies Potential antiviral strategies

N -pentyl idonojirimycin (NP-IDJ) NB-DNJNP-IDJ Glucose geometry Idose geometry

Lys-Lys-Ala-Ala(KKAA) ER retention signal ER retention signal

KKAA CytosolER KKAA ?

N HOOH HO OH N OH OH HO HO N HOOH HO N HOOH HO N-alkylated 7-membered iminosugars Mannosidase inhibitors?

Materials and methods HL60 (human myeloid leukaemia) CGT inhibition Glycosphingolipid analysis Glycosphingolipid analysis RPMI medium RPMI medium + foetal calf serum, + penicillin/streptomycin + L-glutamine 96 h incubation 96 h incubation Initial cell concentration: Initial cell concentration: 2×10 4 cells/ml

Fluorescent labelling with anthralinic acid (2-AA) Fluorescent labelling with anthralinic acid (2-AA) HPLC analysis HPLC analysis Ceramide Glycan Hirudo medicinalis (leech) Ceramide glycanase Extracted with chloroform-methanol Extracted with chloroform-methanol Purified using reverse-phase C18 columns Purified using reverse-phase C18 columns Analysis Materials and methods CGT inhibition

Materials and methods Glucosidase inhibition Free oligosaccharide analysis Free oligosaccharide analysis Misfolded protein Glucose Mannose N-acetylglucosamine PNGase ENGase Mannosidase M5N Lysosome G3M5N Free oligosaccharide (FOS)

NB-DNJ 500 µM Untreated HL60 M5N G1M5N M4N G3M5N Materials and methods Glucosidase inhibition Default pathway for ERAD

Untreated control NP-IDJ 500 µM NB-DNJ 500 µM Results: NP-IDJ NP-IDJ vs. NB-DNJ: HL60 cells FOS profile M5N M4N G3M5N

NP-IDJ 500 µM NP-IDJ 100 µM NP-IDJ 50 µM NP-IDJ 5 µM Results: NP-IDJ NP-IDJ: HL60 cells FOS profile, 24h incubation M5N M4N G3M5N

Results: NP-IDJ NP-IDJ vs. NB-DNJ: HL60 cells FOS profile

Untreated control NP-IDJ 500 µM NB-DNJ 500 µM Results: NP-IDJ NP-IDJ vs. NB-DNJ: HL60 cells GSL profile Lac-Cer GM3 pG Sialyl-pG

Results: NP-IDJ NP-IDJ vs. NB-DNJ: HL60 cells GSL profile

Untreated control KKAA-DNJ 100 µM NB-DNJ 100 µM Results: KKAA-DNJ KKAA-DNJ: HL60 cells FOS profile, 24h incubation G3M5N M5N M4N G1M5N

KKAA-DNJ 100 µM KKAA-DNJ 10 µM KKAA-DNJ 1 µM Results: KKAA-DNJ KKAA-DNJ: HL60 cells FOS profile, 24h incubation M4N M5N G1M5N

Untreated control KKAA-DNJ 100 µM NB-DNJ 100 µM Results: KKAA-DNJ KKAA-DNJ vs. NB-DNJ: HL60 cells FOS profile, 72h incubation M4N M5N G1M5N G3M5N

Results: KKAA-DNJ KKAA-DNJ vs. NB-DNJ: HL60 cells FOS profile, 24h incubation

Results: KKAA-DNJ KKAA-DNJ vs. NB-DNJ: HL60 cells FOS profile, 72h incubation

? Cytosol ER KKAA ? Ceramide-specific glucosyltransferase

Untreated control KKAA-DNJ 200 µM NB-DNJ 200 µM Results: KKAA-DNJ KKAA-DNJ vs. NB-DNJ: HL60 cells GSL profile Lac-Cer GM3 Sialyl-pG pG

Results: KKAA-DNJ KKAA-DNJ vs. NB-DNJ: HL60 cells GSL profile

Results: KKAA-DNJ KKAA-DNJ: in vitro α-glucosidase inhibition IC 50 : 83 µM NB-DNJ IC 50 : 53±16 µM

Results: 7-membered iminosugars 148 vs control: HL60 cells FOS profile Untreated control µM M9N M8N M7N M6N M5N M4N

M9N Kifunensine: mannosidase inhibitor Results: 7-membered iminosugars Untreated control Kifunensine 100 µM

Results: 7-membered iminosugars 149 vs control: HL60 cells FOS profile M9N Untreated control µM

Results: 7-membered iminosugars 266 vs control: HL60 cells FOS profile Untreated control µM

265 vs control: HL60 cells FOS profile Results: 7-membered iminosugars M5N M4N M3N M2N M6N M7N M8N M9N Untreated control µM

OH N OHHO OH OHConclusions NP-IDJ No effect on FOS production No inhibition of α-glucosidases No inhibition of α-glucosidases Significant decrease of GSL levels Effective inhibition of CGT Effective inhibition of CGT Possible therapeutic alternative to NB-DNJ Possible therapeutic alternative to NB-DNJ

Conclusions KKAA-DNJ N OH HO HO OH O KKAA No effect on FOS production Low rates of uptake Low rates of glucosidase inhibition Normal in vitro glucosidase inhibition Low effect on GSL biosynthesis Low rates of CGT inhibition Permeabilization with transfectin?

Strong increase of M2N-M6N concentrations Strong increase of M6N-M9N concentrations Decrease of M4N-M5N concentrations Low or no increase of M7N-M9N concentrations Conclusions N-alkylated 7-membered iminosugars N HOOH HO OH N OH OH HO HO N HOOH HO N HOOH HO No effect

Acknowledgements Dr. Terry Butters Dr. Terry Butters Group Group Oxford university Oxford university St.-Petersburg State University St.-Petersburg State University

St. Mary Le Bow