RNA and Protein Synthesis Ribonucleic acid: another type of nucleic acid that works with DNA to make proteins
mRNA From nucleus to cytoplasm DNA transcription nucleus cytoplasm translation trait protein
DNA vs. RNA DNA deoxyribose sugar nitrogen bases G, C, A, T T : A C : G double stranded 1 type RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded 3 types: M, R, & T
Transcription Making mRNA from DNA DNA strand is the template (pattern) match bases U : A G : C Enzyme RNA polymerase
Matching bases of DNA & RNA Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA
Matching bases of DNA & RNA Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA
Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A ACC RNA polymerase C C C C C G G G G A A A A A
Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA UCCCCCCAAUGUGAAAAAGGGGUU ribosome
protein cytoplasm nucleus trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome
How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA aa How? mRNA UCCCCCCAAUGUGAAAAAGGGGUU
How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)? ribosome aa
AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? Codon = block of 3 mRNA bases codon ribosome
For ALL life! strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Start codon AUG methionine Stop codons UGA, UAA, UAG The mRNA code
How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA anti-codon codon tRNA UAC Met GCA Arg CAU Val Anti-codon = block of 3 tRNA bases amino acid
mRNA to protein = Translation The working instructions mRNA The reader ribosome The transporter transfer RNA (tRNA) mRNA UCCCCCCAAUGUGAAAAAGGGGUU aa tRNA GG U aa tRNA UAC aa tRNA GA C aa AGU ribosome
aa mRNA From gene to protein DNA transcription nucleus cytoplasm protein translation trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome tRNA aa
Mutations Changes to DNA are called mutations change the DNA changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait
Types of Mutations 1.Point mutation: change in a single base pair in DNA (substitution) THE DOG BIT THE CAT THE DOG BIT THE CAR Missense mutation = changes amino acid Nonsense mutation = change to STOP Silent mutation = no change in protein
Types of Mutations 2. Frameshift mutation: a single base pair is added or deleted and shifts the reading of the codons THE DOG BIT THE CAT THE DOG SBI TTH ECA T
Mutations 3. Chromosomal mutations: any change in the structure or number of chromosomes, common in plants deletion: part of a chromosome is removed insertion and translocation: part of a chromosome breaks off and attaches to another chromosome inversion: part of a chromosome breaks off and is reinserted backwards
Examples of chromosomal mutations deletion duplication inversion translocation 12.4
Gene Regulation Only a small percent of genes are expressed (~3%) Genes that are expressed have a proteins that control their expression “TATA box”: sequence at the beginning of a transcription site in eukaryotes
The Operon Four regions of DNA control the production of a protein a structural gene that holds the codons for the amino acid sequence found in the enzyme. an operator region right in front of the structural gene. a promotor region where the RNA polymerase will bind to the DNA. a regulator gene which has a role in controling the transcription from the structural gene. The combined region of the operator and structural gene is called an operon.
Animations hill.com/sites/ /student_view0/chapter15/animations.html#