Transcriptome analysis of the TnrA regulon in Bacillus subtilis Hanne Jarmer Center for Biological Sequence analysis Technical University of Denmark.

Slides:

Advertisements

Similar presentations

GENE REGULATION Virtually every cell in your body contains a complete set of genes But they are not all turned on in every tissue Each cell in your body.

Advertisements

The lac operon.

Ch 18 Gene Regulation. Consider: A multicellular organism (Pliny) Do each of his cells have the same genes? Yes, with an exception: germ cells are haploid.

Chapter 17 - Amino Acid Metabolism

Transcriptional regulation of the fad regulon genes of Escherichia coli by ArcA Chao WANG Sept. 13, 2006.

Medical Genetics & Genomics

Gene Expression AP Biology.

4.1 (Part 1) Flow diagram for gene expression profiling.

Gene regulation. Gene expression models  Prokaryotes and Eukaryotes employ common and different methods of gene regulation  Prokaryotic models 1. Trp.

Chapter 17 Regulation of gene expression in bacteria: lac Operon of E. coli trp operon of E. coli.

Copyright © 2005 Brooks/Cole — Thomson Learning Biology, Seventh Edition Solomon Berg Martin Chapter 13 Gene Regulation.

1 Molecular genetics of bacteria Emphasis: ways that bacteria differ from eukaryotes DNA structure and function; definitions. DNA replication Transcription.

CHAPTER 8 Metabolic Respiration Overview of Regulation Most genes encode proteins, and most proteins are enzymes. The expression of such a gene can be.

1 MicroArray -- Data Analysis Cecilia Hansen & Dirk Repsilber Bioinformatics - 10p, October 2001.

Viral & Prokaryotic Genetics “Simple” Model Systems.

Introduction to DNA Microarrays Todd Lowe BME 88a March 11, 2003.

Microarrays Dr Peter Smooker,

1 Genetic regulation Genotype is not phenotype: bacteria possess many genes that they are not using at any particular time. Transcription and translation.

Parallel human genome analysis: Microarray-based expression monitoring of 1000 genes Mark Schena, Dari Shalon, Renu Heller, Andrew Chai, Patrick O. Brown,

Functional annotation and network reconstruction through cross-platform integration of microarray data X. J. Zhou et al

RNA-Seq An alternative to microarray. Steps Grow cells or isolate tissue (brain, liver, muscle) Isolate total RNA Isolate mRNA from total RNA (poly.

Introduce to Microarray

Review of important points from the NCBI lectures. –Example slides Review the two types of microarray platforms. –Spotted arrays –Affymetrix Specific examples.

Next Generation Microarray Technology: Overview of Febit’s Geniom One ® H. Bjørn Nielsen Center for Biological Sequence analysis Technical University of.

Introduction to DNA microarrays DTU - January Hanne Jarmer.

Microbial Genomics Genetic engineering, DNA sequencing of bacterial genomes and the transcriptome. MBV

Microarrays: Basic Principle AGCCTAGCCT ACCGAACCGA GCGGAGCGGA CCGGACCGGA TCGGATCGGA Probe Targets Highly parallel molecular search and sort process based.

Exploring the Metabolic and Genetic Control of Gene Expression on a Genomic Scale Joseph L. DeRisi, Vishwanath R. Iyer, Patrick O. Brown Science Vol. 278.

Analysis of microarray data

with an emphasis on DNA microarrays

Genome of the week - Deinococcus radiodurans Highly resistant to DNA damage –Most radiation resistant organism known Multiple genetic elements –2 chromosomes,

HC70AL Spring 2009 Gene Discovery Laboratory RNA and Tools For Studying Differential Gene Expression During Seed Development 4/20/09tratorp.

Microarrays (Gene Chips) Pioneered by Pat Brown in mid 1990’s To monitor thousands of mRNAs simultaneously Comparative Northern blot on thousands of genes.

The European Nutrigenomics Organisation Deciding and acting on quality of microarray experiments in genomics Chris Evelo BiGCaT Bioinformatics Maastricht.

Goals of today’s lecture 1)Describe the basics of prokaryotic gene regulation -operons, negative and positive regulation 2)Illustrate the use of genetics.

Global network analysis of drug tolerance, mode of action and virulence in methicillin-resistant S. aureus Bobby Arnold Alex Cardenas Zeb Russo Loyola.

Gene expression and DNA microarrays Old methods. New methods based on genome sequence. –DNA Microarrays Reading assignment - handout –Chapter ,

Gene Expression Data Qifang Xu. Outline cDNA Microarray Technology cDNA Microarray Technology Data Representation Data Representation Statistical Analysis.

GENE REGULATION. Virtually every cell in your body contains a complete set of genes Virtually every cell in your body contains a complete set of genes.

Inferring Function From Known Genes Naomi Altman Nov. 06.

Bacterial Gene Expression and Regulation

Regulation of Gene expression by E. Börje Lindström This learning object has been funded by the European Commissions FP6 BioMinE project.

1 Gene regulation in Prokaryotes Bacteria were models for working out the basic mechanisms, but eukaryotes are different. Some genes are constitutive,

Chapter 16 – Control of Gene Expression in Prokaryotes

Transcriptome analysis of the TnrA regulon in Bacillus subtilis Hanne Jarmer Center for Biological Sequence analysis Technical University of Denmark.

1 FINAL PROJECT- Key dates –last day to decided on a project * 11-10/1- Presenting a proposed project in small groups A very short presentation (Max.

Topic intro slides More complete coverage of components involved in gene expression More information on expression technologies -what would the ideal chip.

CONTROL OF GENE EXPRESSION The development of an organism must involve the switching on and off of genes in an orderly manner. This is not fully understood.

1 Gene Regulation Organisms have lots of genetic information, but they don’t necessarily want to use all of it (or use it fully) at one particular time.

Gene Expression Analysis. 2 DNA Microarray First introduced in 1987 A microarray is a tool for analyzing gene expression in genomic scale. The microarray.

Introduction to Microarrays.

Lecture 7. Functional Genomics: Gene Expression Profiling using

DTU - January Hanne Jarmer

Data Mining the Yeast Genome Expression and Sequence Data Alvis Brazma European Bioinformatics Institute.

Gene Expression and Regulation

1 Molecular genetics of bacteria Gene regulation and regulation of metabolism Genetic exchange among bacteria Bacteria are successful because 1.They carefully.

Microarray Technology. Introduction Introduction –Microarrays are extremely powerful ways to analyze gene expression. –Using a microarray, it is possible.

Genome annotation and search for homologs. Genome of the week Discuss the diversity and features of selected microbial genomes. Link to the paper describing.

Microarray (Gene Expression) DNA microarrays is a technology that can be used to measure changes in expression levels or to detect SNiPs Microarrays differ.

ANALYSIS OF GENE EXPRESSION DATA. Gene expression data is a high-throughput data type (like DNA and protein sequences) that requires bioinformatic pattern.

Integrated Genomic and Proteomic Analyses of a Systematically Perturbed Metabolic Network Science, Vol 292, Issue 5518, , 4 May 2001.

Gene expression and DNA microarrays No lab on Thursday. No class on Tuesday or Thursday next week –NCBI training Monday and Tuesday –Feb. 5 during class.

Post-genomic Virology The impact of bioinformatics, microarrays and proteomics on investigating host and pathogen interactions Steven Masson.

Statistical Analysis for Expression Experiments Heather Adams BeeSpace Doctoral Forum Thursday May 21, 2009.

Other uses of DNA microarrays

Microarray: An Introduction

BIOBASE Training TRANSFAC ® Containing data on eukaryotic transcription factors, their experimentally-proven binding sites, and regulated genes ExPlain™

Transcription(I) 王之仰.

Introduction to Microarrays.

Molecular genetics of bacteria

Presentation transcript:

Transcriptome analysis of the TnrA regulon in Bacillus subtilis Hanne Jarmer Center for Biological Sequence analysis Technical University of Denmark

Bacillus subtilis Bacillus means rod-shaped bacteria. The rod in the gut was Bacillus coli and the rod found in rotting hay was Bacillus subtilis Louis Pasteur used heat-attenuated Bacillus anthracis as the first anti-bacterial vaccine Subtilis means: highly sensitive – weak – mild (subtle) Soil bacteria typically found in association with plants

Bacillus subtilis B. subtilis has been used for studying different systems: gene regulation, metabolism and differentiation The second most extensively studied bacteria The first to be transformed in the laboratory. This process was optimized by Anagnostopoulos and Spizizen in 1961 Bacillus subtilis

Fully sequenced and has around 4,225 predicted genes (SubtiList, R16.1) Non-hasardous Easy to grow and manipulate genetically Sporulates Secretes proteins Of extensive interest to industry Bacillus subtilis

NH glutamateglutamine Glutamine synthetase

tnrA TnrA GlnR GlnA - Glutamine Synthetase ureAureBureC glnRglnA Access to nitrogen through alternative pathways gabP nasA pucR ykzB-ykoL nasABCDEF nrgAB ansZ ycs-kip pucABCDE gltAB

wildtype versus mutant in the same medium Allantoin NH 4 /glutamate Glutamate TnrA wildtype versus wildtype in different media Glutamine GlnA GlnR

Pathway specific regulator of purine catabolism TnrA Purine catabolism PucR ALLANTOIN

mRNA cDNA Cy3-cDNACy5-cDNA SAMPLE REFERENCE

PCR products from ~97% of all genes spotted onto poly-L-lysine coated glass microscope slides using a 16-pin microarrayer Hybridized to Cy3 and Cy5 labeled first-strand cDNAs Scanned B. subtilis microarrays

NUMBERS: 3 hybridizations (arrays) per culture 2 spots per gene on each array 2 different growth experiments 2 x 3 x 2 = 12 intensities for each gene

Normalization.... is it worth it?

Allantoin: 132 Glutamine: 60 Glutamate: 91 TnrA: 239 GlnA: 159 GlnR: 67 RESULT: 6 lists

Extraction: The gene should be significantly affected in at least two of the six experiments (except “Glutamine”) List of ~100 genes highly likely to be involved in the TnrA-GlnA system Visualization: ClustArray Extraction - Visualization

COFFEE BREAK - 10 MINUTES

GlnR GlnA TnrA Glutamine Glutamate Allantoin pucA yrbD nrgB nrgA pucJ hxlA ywpH pucL pucK ureC ureB gabP ywfM yhdG dppA pucB nasA nasE ykoL tnrA ysnE cotZ guaD Activated by TnrA or PucR? Opposite expression profile – common TnrA regulated regulator?

What is the function of these genes ? yrbD: sodium/proton-dependent alanine carrier hxlA: 3-hexulose-6-phosphate synthase ywpH: single-strand DNA-binding protein ywfM: unknown yhdG: amino acid transporter dppA: D-alanyl-aminopeptidase ysnE: similar to acetyltransferase cotZ: spore coat protein

TnrA box = TGT.A T.ACA Built a Weight Matrix from known sites searched the upstream regions sorted and extracted clustered and displayed

pucA yrbD nasA nrgA pucJ ykoL tnrA pucR ykzB yyaF pucH ywoE gabP yhdG ycsF GlnR GlnA TnrA Glutamine Glutamate Allantoin Repressed by TnrA ? yuiA yycB yodF gltA hisI yocR bioA Repressed by TnrA? GlnR GlnA TnrA Glutamine Glutamate Allantoin braB glnR Repressed by GlnR ?

TnrA activated genes? yrbD and yhdG have the TnrA box in a plausible position Experimental investigations yrbD:similar to sodium/proton-dependent alanine carrier protein yhdG:similar to amino acid transporter yyaF:similar to GTP-binding protein

TnrA repressed genes? Experimental investigations yuiA: ?? yycB:similar to permease yodF:similar to proline permease hisI:phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP pyrophosphohydrolase yocR:similar to sodium-dependent transporter bioA:adenosylmethionine-8-amino-7- oxononanoate aminotransferase

GlnR repressed gene ? braB:branched-chain amino acid transporter Experimental investigations A GlnR knockout with a braB-lacZ fusion do have higher  -galactosidase activity than the wildtype.... and two putative binding sites

ureP3 gatgtgaataaatataacaaaaaaagaagctgatttggtcaaggtaactaaattttttaaatattctttgaattaataggcctcttctatataatgatgacataagttgtaaacttttataacatcat g cggtacaaggtatgatatttatgttaccataacaaaatttaatagaaaattacgaaaaactagtattgacttctaatttttttaccatataataagatttgttcgtttcgtcatattatctgacaatta braB TnrA box

Verified new discoveries: ureABC (urease operon) is activated by PucR ACTIVITY OF yhdG + N– N allantoin glutamine wildtype: TnrA-mutant:1.000 GlnA -mutant : PucR -mutant : yrbD and yhdG:activated by TnrA repressed by PucR

...more verified new discoveries Compentence is induced in glutamate medium = one-step transformation procedure A TnrA mutant has reduced competence...only 2% of wildtype level TnrA somehow regulates the development of competence

Novozymes Biotech Inc – Davis, California: Randy Berka Maria Tang Alan Sloma Department of Microbiology – Boston University: Susan Fisher Lewis Wray, Jr. Jaclyn Brandenburg Section of Molecular Microbiology - DTU: Hans Henrik Saxild Lars Beier Center for Biological Sequence analysis – DTU: Steen Knudsen Chris Workman (software) Laurent Gautier (statistics) The array group (discussions) Kristine Dahlin Acknowledgements

Todays exercise inferring regulatory networks

Gene Experiment TnrA GlnA GlnR nrgA glnR purE

AB D C AB D C