Section 12-3 RNA & Protein Synthesis

Slides:



Advertisements
Similar presentations
RNA and Protein Synthesis
Advertisements

CH 11.4 & 11.5 “DNA to Polypeptide”.
Translation Proteins are made by joining amino acids into long chains called polypeptides (proteins). Each polypeptide contains a combination of any or.
RNA and Protein Synthesis
Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.
RNA and Protein Synthesis
RNA and Protein Synthesis
10-2: RNA and 10-3: Protein Synthesis
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
Protein Synthesis Chapter 11.
From DNA to Proteins Lesson 1. Lesson Objectives State the central dogma of molecular biology. Describe the structure of RNA, and identify the three main.
RNA & Protein Synthesis Intro Genes code DNA instructions that control the production of proteins within the cell. Genes The first step in decoding.
Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis
RNA Ribonucleic acid single stranded also made of nucleotides.
Transcription and Translation
RNA and Protein Synthesis
RNA and Protein Synthesis
RNA AND PROTEIN SYNTHESIS RNA vs DNA RNADNA 1. 5 – Carbon sugar (ribose) 5 – Carbon sugar (deoxyribose) 2. Phosphate group Phosphate group 3. Nitrogenous.
VII RNA and Protein Synthesis
Transcription and Translation
Protein Synthesis 12-3.
By: Anne Russell, Madelyn Stroder, Hannah Black, And Bailey Mills.
Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.
RNA Ribonucleic Acid. Structure of RNA  Single stranded  Ribose Sugar  5 carbon sugar  Phosphate group  Adenine, Uracil, Cytosine, Guanine.
RNA and PROTEIN SYNTHESIS Chapter 13-1 & 13-2
The Genetic Code.
RNA. RNA RNA: Ribonucleic Acid. Takes info in DNA to create proteins DNA RNA PROTEIN.
Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.
Copyright Pearson Prentice Hall
RNA & Protein Synthesis
RNA & Protein Synthesis. RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins within the cell DNA codes.
DNA & Protein Synthesis. Vocabulary terms to learn: gene messenger RNA (mRNA) ribosomal RNA (rRNA) transfer RNA (tRNA) transcription RNA polymerase codon.
RNA & Protein Synthesis Ribose RNA. DNARNA StructureDouble Stranded Single Stranded Bases- PurinesAdenine (A) Guanine (G) Bases - Pyrimidines Cytosine.
RNA & Protein Synthesis. RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins within the cell DNA codes.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.
Chapter 12-3: RNA & Protein Synthesis Essential Questions:  What are 3 types of RNA?  What is the function of 3 types of RNA?  What happens during transcription?
Placed on the same page as your notes Warm-up pg. 48 Complete the complementary strand of DNA A T G A C G A C T Diagram 1 A T G A C G A C T T A A C T G.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…
Protein Synthesis Notes. Main Idea DNA codes for RNA, which guides protein synthesis. Protein Synthesis is the making of proteins.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
RNA. RNA RNA: Ribonucleic Acid. Takes info in DNA to create proteins DNA RNA PROTEIN.
Chapter 12.3 DNA, RNA and Protein DNA, RNA, and Protein Molecular Genetics Central Dogma  RNA - Contains the sugar ribose and the base uracil,
 Genes are coded DNA instructions that will control the production of proteins  These messages have to change to RNA to be decoded.  RNA will give.
Notes: Transcription DNA vs. RNA
RNA and Protein Synthesis
PROTEIN SYNTHESIS CHAPTER 10 section 4
RNA & Protein synthesis
From DNA to Proteins Lesson 1.
Copyright Pearson Prentice Hall
12-3 RNA & Protein Synthesis
12-3 RNA and Protein Synthesis
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
RNA and Protein Synthesis
RNA & Protein Synthesis
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
RNA and Protein Synthesis
RNA & Protein synthesis
Transcription Using DNA to make RNA.
Protein Synthesis Chapter 10.
Presentation transcript:

Section 12-3 RNA & Protein Synthesis Chapter 12 DNA & RNA Section 12-3 RNA & Protein Synthesis

RNA Used For Protein Synthesis Types of RNA RNA Used For Protein Synthesis Three Types of RNA Messenger RNA, mRNA Ribosomal RNA, rRNA Transfer RNA, tRNA

Types of RNA mRNA rRNA tRNA Template to construct protein. It brings the message from the DNA to the ribosome. rRNA Part of ribosome structure tRNA Transports amino acids from cytoplasm to the ribosomes

Transcription The process of copying part of the DNA nucleotide sequence into a complementary sequence of RNA

Transcription Requires the enzyme RNA Polymerase Step 1. RNA polymerase binds to DNA and separates the DNA strands. Step 2. RNA Polymerase uses one strand of DNA as a template to polymerize nucleotides into RNA

After Making mRNA Introns (active segments of nucleotides) RNA Editing After Making mRNA Introns Are Snipped Out Exons Remain, (active segments of nucleotides)

The Genetic Code Proteins are long chains of amino acids. There are 20 different amino acids The order of amino acids in the protein determine its shape and function

There are 20 amino acids but only The Genetic Code There are 20 amino acids but only 4 bases in RNA Adenine A Cytosine C Guanine G Uracil U

The Genetic Code The genetic code consists of “words” three bases long Each “word” is called a Codon: three consecutive nucleotides that specifies a single amino acid

UCGCACGGU = RNA Sequence CAC codes for Histidine The Genetic Code For Example: UCGCACGGU = RNA Sequence UCG-CAC-GGU = Codons UCG codes for Serine CAC codes for Histidine GGU codes for Glycine

Code Wheel

The Genetic Code 4 Bases Codons Defined with 3 Bases There Are 64 Possible 3-base codons Since there are only 20 amino acids, some amino acids are represented by multiple codons

Translation Translation is the process of of decoding the mRNA into a polypeptide chain Ribosomes Read mRNA and construct the proteins

Translation Step 1 mRNA leaves the Nucleus

Translation Step 2 mRNA binds to the ribosome. tRNA attaches Anticodons on the tRNA line up with codons on mRNA The other end of the tRNA is an amino acid

Translation Step 3 Ribosome connects the amino acids together as they come into the ribosome

Translation Step 4 A polypeptide (Chain of Amino Acids) is formed. Polypeptide chain grows until the mRNA STOP Codon is reached

Blueprints of the Master Plan The Roles of RNA & DNA DNA = Master Plan RNA = Blueprints of the Master Plan

Proteins At the end of translation a protein is formed. Proteins are enzymes that catalyze and regulate chemical reactions Proteins can also be structural.

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2024 SlidePlayer.com. Inc. All rights reserved.