genetic variation is meaningful only in the context of a population the minor allele frequency f says how often a particular allele (variant) occurs at a particular site in a given population; by definition it is < 0.5 ccagtcagagAtgtgcacatggcttagttttcatacaGagcctgggctgggggtggggtg ccagtcagagAtgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg ccagtcagagttgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg ccagtcagagttgtgcacatggcttagttttcatacacagcctgggctCggggtggggtg ccagtcagagttgtgcacatgTcttagttttcatacacagcctgggctgggggtggggtg ccagtcagagttgtgcacatggcttagttttcatacaGagcctgggctgggggtggggtg f = 4/10 f = 1/10 f = 2/10 individuals 1-10
single nucleotide polymorphisms (SNPs) are essentially all bi-allelic; tri-allelic SNPs are very rare two individuals vary about every 1000 bp; worldwide however all but a few % of the genome is variable in somebody most SNPs are evolutionarily neutral, in part because most of the genome itself is non-functional distributions of minor allele frequencies conform to a 1/[f·(1-f)] formula, in accordance with neutral theory predictions rare SNPs with smaller frequencies tend to be more recent in origin and more population specific
most SNPs are at low frequency this is the observed frequency distribution from the complete sequencing a large population; however most SNP discovery projects sequence a small population and then consider the absence or presence of those previously discovered SNPs in large population; this is known to under-estimate the number of rare variants 0.1 0.2 0.3 0.4 0.5 250 500 750 1000 f (minor allele) # of SNPs # of SNPs found = 1541 NonSyn Synon 5'-UTR 3'-UTR Frame Splice 5'-Flank 3'-Flank Intron
Halushka MK, …, Chakravarti A. 1999. Nat Genet 22: 239-347 higher variation in African relative to European-American populations is consistent with “Out of Africa” model i.e., European-American populations grew out of African populations Halushka MK, …, Chakravarti A. 1999. Nat Genet 22: 239-347
population specific SNPs are more recent in origin and found at lower allele frequency than shared SNPs minor allele frequencies are classified by occurrence within individuals of either African or European descent (population specific), or presence in both (shared)
Lewontin’s (in)famous paper on non-existence of “race” in genetics Lewontin RC. 1972. "The apportionment of human diversity“, in Evolutionary Biology 6: 391-398 most of the variations (85%) found in human populations is found within local geographic groups and any differences attributable to race groups is just a small fraction of human genetic variability (15%); race is an invalid taxonomic construct because the probability of a racial misclassification is approximately 30% based on a single genetic locus Edwards AW. 2003. Human genetic diversity: Lewontin's fallacy. Bioessays 25: 798-801 even if the probability of misclassifying an individual’s race based on a single locus is as high as 30%, the misclassification probability based on 10 loci can drop to a few percent
genetic structure of human populations Rosenberg NA, …, Feldman MW. 2002. Science 298: 2381-2385 This analysis is based on 377 microsatellites in 1056 individuals from 52 populations. Variations within populations account for 93 to 95% of the data. Nonetheless we can identify clusters that are consistent with known populations. K is chosen in advance. For any given K, each individual is represented by a thin vertical line, which is partitioned into K colored segments indicating the individual’s estimated membership in the preordained K clusters. Africa Asia Europe
BUT most of the genetic variation is within populations
genes and environment interact in determination of phenotypic difference Mountain JL, Risch N. 2004. Nat Genet 36: S48-S53. (a) Absolute pitch manifests primarily in the group with early (before age 6) musical training, is familial and may have a genetic component, but that genetic influence does not manifest in the absence of early musical training. The difference is primarily environmental. (b) Phenylthiocarbamide tasting gene (PTC) on chromosome 7 is polymorphic in European populations, with the low-sensitivity haplotype at frequency 0.50 and the homozygotes at frequency 0.25. This haplotype is missing in Native American populations. Hence the difference is primarily genetic.
the more politically controversial traits are much more environmental in nature and much less genetic there is always a statistical distribution and so if we judge people as individuals (unlike insurance companies) there would be no problem
a population threshold for functional polymorphisms Wong GK, …, Yu J. 2003. Genome Res 13: 1873-1879 0.1 0.2 0.3 0.4 0.5 1 1.5 2 f (minor allele) NON / SYN non-synonymous = 337, synonymous = 279 f 6%
explaining the increase in the number of non-synonymous SNPs unexpected prevalence of non-synonymous SNPs at frequencies of greater than 1% can be explained away if balancing selection (where heterozygotes gain a selective advantage despite the homozygotes being severely ill) is more common than assumed given that the sequenced individuals are from different populations, these data are also consistent with there being 11 population-specific SNPs for each population-independent SNP, which further debunks Lewontin’s argument that there is no genetic basis for race positive adaptation to the environmental changes of the last 500 to 1000 generations, or 10000 to 20000 years, will give the same effect; such a time scale coincides with the end of the ice age, the melting of the glaciers, and the development of civilization
theoretical time progression for positively selected alleles 0.4 0.8 1.2 1.6 2 0.1 0.5 0.9 1 t (generations) / 10 3 f (favored) f0=0.010, variable selection coefficient s D: s=0.05 D: s=0.10 D: s=0.15 R: s=0.05 R: s=0.10 R: s=0.15 dominant recessive passage from 0.1 to 0.9 is very fast
natural selection is not what it used to be, especially in Seattle