DIALing the IBIVU Vrije Universiteit Amsterdam Jaap Heringa Centre for Integrative Bioinformatics VU (IBIVU) Faculty of Sciences / Faculty of Earth and.

Slides:



Advertisements
Similar presentations
Centre for Integrative BioInformatics IBIVU Bioinformatics Masters in The Netherlands Contents: Nine bioinformatics Masters programmes at eight Dutch universities.
Advertisements

LESSON 1: What is Genetic Research? PowerPoint slides to accompany Using Bioinformatics : Genetic Research.
Microarray Data Analysis Day 2
Prof. Carolina Ruiz Computer Science Department Bioinformatics and Computational Biology Program WPI WELCOME TO BCB4003/CS4803 BCB503/CS583 BIOLOGICAL.
School of Computer Engineering Master of Science (Bioinformatics) A/P Kwoh Chee Keong 2009 presented by.
Bioinformatics at WSU Matt Settles Bioinformatics Core Washington State University Wednesday, April 23, 2008 WSU Linux User Group (LUG)‏
Bioinformatics For MNW 2 nd Year Jaap Heringa FEW/FALW Integrative Bioinformatics Institute VU (IBIVU) Tel ,
AP Biology Teaching Biology Through Bioinformatics Real world genomics research in your classroom Kim B. Foglia Division Ave. High School Levittown.
Fokkerij in genomics tijdperk Johan van Arendonk Animal Breeding and Genomics Centre Wageningen University.
Mathematical Statistics, Centre for Mathematical Sciences
Bioinformatics at IU - Ketan Mane. Bioinformatics at IU What is Bioinformatics? Bioinformatics is the study of the inherent structure of biological information.
Bioinformatics Master’s Course Genome Analysis ( Integrative Bioinformatics ) Lecture 1: Introduction Centre for Integrative Bioinformatics VU (IBIVU)
1 SC'03, Nov. 15–21, 2003 A Million-Fold Speed Improvement in Genomic Repeats Detection John W. Romein Jaap Heringa Henri E. Bal Vrije Universiteit, Amsterdam.
Edward H. Shortliffe, MD, PhD College of Physicians & Surgeons
Master’s course Bioinformatics Data Analysis and Tools Lecture 1: Introduction Centre for Integrative Bioinformatics FEW/FALW C E N T.
Structural Genomics – an example of transdisciplinary research at Stanford Goal of structural and functional genomics is to determine and analyze all possible.
Pathways Bioinformatics & Biomolecular Center at the City College of New York Marshak Science Building, Room 1102 Tel: 212/ Fax: 212/
Gene expression analysis summary Where are we now?
University of Louisville The Department of Bioinformatics and Biostatistics.
The Golden Age of Biology DNA -> RNA -> Proteins -> Metabolites Genomics Technologies MECHANISMS OF LIFE Health Care Diagnostics Medicines Animal Products.
Computational Molecular Biology (Spring’03) Chitta Baral Professor of Computer Science & Engg.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
Course Sequence Analysis for Bioinformatics Master’s Bart van Houte, Radek Szklarczyk, Walter Pirovano, Jaap Heringa
Introduction to Genomics, Bioinformatics & Proteomics Brian Rybarczyk, PhD PMABS Department of Biology University of North Carolina Chapel Hill.
Scientific Data Mining: Emerging Developments and Challenges F. Seillier-Moiseiwitsch Bioinformatics Research Center Department of Mathematics and Statistics.
Systems Biology Biological Sequence Analysis
Introduction to Bioinformatics (Lecture for CS498-CXZ Algorithms in Bioinformatics) Aug. 25, 2005 ChengXiang Zhai Department of Computer Science University.
Protein Structures.
1 The Department of Computational Biology University of Pittsburgh School of Medicine Hagai Meirovitch.
Systematic Analysis of Interactome: A New Trend in Bioinformatics KOCSEA Technical Symposium 2010 Young-Rae Cho, Ph.D. Assistant Professor Department of.
Bioinformatics Jan Taylor. A bit about me Biochemistry and Molecular Biology Computer Science, Computational Biology Multivariate statistics Machine learning.
Meer perspectief Master’s programme in Bioinformatics Bio-tools for the Future International 2-year Bioinformatics Master’s Programme.
9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.
Professional Development In A Workforce Program Linnea Fletcher PhD Department Chair, Biotechnology Co-PI, Bio-Link ATE Center Grant in Biotechnology.
Bioinformatics.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
Bioinformatics and medicine: Are we meeting the challenge?
Master’s course Bioinformatics Data Analysis and Tools Lecture 1: Introduction Centre for Integrative Bioinformatics FEW/FALW
SYSTEMS BIOLOGY AND NEUROENGINEERING Christine P. Hendon, PhD Assistant Professor Electrical Engineering.
Mark van Rossum Mark van Rossum Edinburgh.
C E N T R F O I G A V B M S U 2MNW/3I/3AI/3PHAR bachelor course Introduction to Bioinformatics Lecture 1: Introduction Centre for Integrative Bioinformatics.
What is Genetic Research?. Genetic Research Deals with Inherited Traits DNA Isolation Use bioinformatics to Research differences in DNA Genetic researchers.
CSCI 6900/4900 Special Topics in Computer Science Automata and Formal Grammars for Bioinformatics Bioinformatics problems sequence comparison pattern/structure.
Bioinformatics For MNW 2 nd Year Jaap Heringa FEW/FALW Centre for Integrative Bioinformatics VU (IBIVU) Tel ,
Agent-based methods for translational cancer multilevel modelling Sylvia Nagl PhD Cancer Systems Science & Biomedical Informatics UCL Cancer Institute.
Introduction to Bioinformatics Biostatistics & Medical Informatics 576 Computer Sciences 576 Fall 2008 Colin Dewey Dept. of Biostatistics & Medical Informatics.
Integrating the Bioinformatic Technology Group into your research programme Introduction People and Skills Examples Integrating the BTG Contacts BHRC Away.
Bioinformatics Core Facility Guglielmo Roma January 2011.
Introduction to Bioinformatics (Lecture for CS397-CXZ Algorithms in Bioinformatics) Jan. 21, 2004 ChengXiang Zhai Department of Computer Science University.
Mining Biological Data. Protein Enzymatic ProteinsTransport ProteinsRegulatory Proteins Storage ProteinsHormonal ProteinsReceptor Proteins.
Course Sequence Analysis for Bioinformatics Master’s Bart van Houte, Radek Szklarczyk, Victor Simossis, Jens Kleinjung, Jaap Heringa
AdvancedBioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2002 Mark Craven Dept. of Biostatistics & Medical Informatics.
Central dogma: the story of life RNA DNA Protein.
An overview of Bioinformatics. Cell and Central Dogma.
Large-scale Prediction of Yeast Gene Function Introduction to Bio-Informatics Winter Roi Adadi Naama Kraus
Computing Research Institute Dean Advisory Committee A. Sameh May 4, 2002.
GeWorkbench Overview Support Team Molecular Analysis Tools Knowledge Center Columbia University and The Broad Institute of MIT and Harvard.
EMBL-EBI Data Archives – An Overview. The EMBL-EBI mission Provide freely available data and bioinformatics services to all facets of the scientific community.
Presenter: Bradley Green.  What is Bioinformatics?  Brief History of Bioinformatics  Development  Computer Science and Bioinformatics  Current Applications.
Performing top research at the Academia
Department of Genetics • Stanford University School of Medicine
Areas of Research Xia Jiang Assistant Professor
Bioinformatics Biological Data Computer Calculations +
C E N T R F O I G A V B M S U 2MNW/3I/3AI/3PHAR bachelor course Introduction to Bioinformatics Lecture 1: Introduction Centre for Integrative Bioinformatics.
Genome organization and Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Protein Structures.
Bioinformatics For MNW 2nd Year
BIOINFORMATICS Summary
1-month Practical Course
Presentation transcript:

DIALing the IBIVU Vrije Universiteit Amsterdam Jaap Heringa Centre for Integrative Bioinformatics VU (IBIVU) Faculty of Sciences / Faculty of Earth and Life Sciences Free University, Amsterdam, The Netherlands

The Centre for Integrative Bioinformatics VU (IBIVU) Vrije Universiteit Amsterdam

Bioinformatics at the VU Core Bioinformatics Section and Integrative Bioinformatics Institute VU (IBIVU) Two founding faculties (FEW, FALW) Towards including three faculties (FEW, FALW, FPP) and VUMC Expertise covering Mathematics (statistics /stochastics), AI (machine learning), (Theoretical) Biology, Molecular Biology/Medicine and Bioinformatics Embeds a number of national and international initiatives

The IBIVU

What kind of bioinformatics research at the IBIVU Integrative bioinformatics –Integrate expertise: Mathematics (statistics), HTP computing, AI, Machine learning, (Molecular) biology, Genomics, Clinical medicine, etc. –Integrate data (e.g. vertical genomics), models and methods –Integrate tool creation and experimental validation Tools directed bioinformatics –strong embedding in computer science (FEW Computer Science Department) Both components give the IBIVU a competitive edge

IBIVU organisation ThematicExecutive Committees Governing Board dean FALW | dean FEW VU-Board (CvB) Vrije Universiteit Directorate Director | co-director Executive committee Thematic Committee chair persons

IBIVU advisory structure Management Advisory Committee Governing Board dean FEW/FALW Board (CvB) Vrije Universiteit Scientific Director | co-director Executive committee Thematic Committees Scientific Advisory Committee Industrial Platform Bsik Ecogenomics IOP- Genomics NWO, STW, EU CMSB IBIVU Assembly

Direction Theme Ecogeno mics Centre Centre for Medical Systems Biology Central FEW/ FALW VUMC Microarray facilities* VUMC Brain Imaging Centre* Systems Biology* 1. Sequence-Structure-Function relationships XXXXX 2. Computation & tool creation XXXXXX 3. Data/method/model integration XXXXXX 4. Comparative genomics / gene prediction XXXXX 5. Network modeling XXXXX 6. Vertical (integrative) genomics XXXXX 7. Integrative visualisation XXXXXX 8. Gene expression (microarray) analysis XXXXX 9. Biostatistics XXXXX 10. Biomolecular informatics (meso scale) XXX 11. Silicon cell (E-cell) XXX 12. Bacterial informatics XXX 13. Tumor informatics XXXX

Current core bioinformatics Informatics Dept. Victor Simossis (PhD) Radek Szklarczyk (PhD) Mischa Sammeth (temp.)(PhD) John Romein (Postdoc) Jens Kleinjung (UD) Jaap Heringa

Tools-directed research in the IBIVU core Bioinformatics Section Integrating external information (e.g. predicted secondary structure) and Multiple Sequence Alignment Genomic and protein internal repeats detection Repeats-filtered multiple sequence alignment Energy-based protein fold recognition (threading) Integrative homology searching (function-biased and knowledge biased searching) Structure-based alignment and alignment verification

Centre for Integrative Faculty of Sciences + Faculty of Earth and Life Sciences Includes: 2 professors 3 group leaders 2.4 assistant professors 2.5 postdocs 1 PhD student

Wider Centre for Integrative Bioinformatics Will include more than 16 research groups supporting: 1.Research directions (e.g. CMSB, Ecogenomics (inter)national initiatives) 2.Contributed projects (at VU faculty level) 3.Small external projects (partially embedded within IBIVU)

Theme Integrative Visualisation Porting and developing SaraGene The SARAThe VU

SaraGene 3D visualisation important for large genomic data sets: Clustering and mapping genes onto location, expressome, metabolome, etc. Many data objects (labels): need 3D to place objects and high resolution to read labels CAVE has good 3D but low resolution (e.g. labels not easily readable) ICwall has bit less 3D capability but much higher resolution.

Data Integration, Analysis and Logistics IBIVU Biostatistics –Plans completed (Aad van der Vaart) –Postdoc Systems Biology-directed integrative bioinformatics –Postdoc