1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic Human Body Organization

Chemical Bonds A union between the electron structures of atoms Atoms can have several orbiting shells that hold their electrons the innermost shell holds a maximum of 2 electrons the outer (or valence) shells can hold up to 8 electrons If the outer shell is complete then the atom is not reactive If the outer shell is not complete then the atom is reactive It tries to fill its outer shell with the electrons from other atoms This is the basis of Chemical Reactions and Chemical Bonds There are three type of Chemical Bonds in the Human Body Ionic Covalent Hydrogen

Macromolecules Are Giant Molecules of Life All Use Carbon Atoms Carbon has only 4 outer shell electrons can make 4 covalent bonds excellent for building molecules hydrocarbons carbon and hydrogen combinations functional groups attachments to carbon backbone increase diversity monomers small molecules that form polymers polymers large molecules made up of monomers

Lipid Bilayer Phospholipids make up the outer layer of all cells

Fluid Mosaic Model Fluid: all components move around freely Mosaic: many different types of proteins on the surface make a mosaic pattern

Membrane Proteins Cell Proteins serve many different purposes

Diffusion

Facilitative Diffusion

Active Transport

Endocytosis Exocytosis Pinocytosis

Animal Cell

DNA Base Pairs: A – T C – G Bases/Base Pairs Nucleotides 3. Nitrogenous Base (deoxyribonucleic acid)

DNA Organization Chromatin organized: DNA Histones One Duplicated Chromosome

Human Chromosomes A Pair of Duplicated Chromosomes Autosomes 46 individual chromosomes / 23 pairs of chromosomes they are the same - code for same type of trait they are different - code for different version of trait Sex Chromosomes

Understanding the Numbers 1 chromosome is 1 large DNA molecule a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG genes per chromosome 30, ,000 genes per human genome

DNA Functions Pass on Genetic Material Replication Mitosis Meiosis Protein Synthesis Transcription Translation

Replication Making an exact copy of DNA Occurs just prior to cell division Double helix unwinds DNA polymerase adds bases Two exact copies are made

Protein Synthesis Transcription DNA to mRNA Translation mRNA to Protein

From Gene to Protein DNA RNA Protein

Genetic Code Codons three base code Code for specific amino acids

Point Mutation Spontaneous Mutation Environmental Insult Mutagenesis Carcinogenesis Mutation is corrected

Point Mutation Mutation is not corrected Mutation is corrected

Two-Hit Hypothesis Born with 2 genes or alleles for any given disease: one from mom one from dad If one is bad, this increases your chance of getting the disease

Animal Tissues Epithelial Tissue Connective Tissue Muscular Tissue Nervous Tissue

Epithelial Tissue Function filtration lubrication secretion Classification simple stratified squamous cuboidal columnar

Simple Epithelial Tissue Squamous Cuboidal Columnar

Stratified Squamous Epithelium

Connective Tissue Function binds together tissues and organs supports tissues and organs strengthens other tissues and organs protects other tissues and organs insulates other tissues and organs Composed of cells matrix ground substance fibers (collagen, elastic, reticular)

Connective Tissue Loose Connective Tissue Dense, Irregular Connective Tissue Dense, Regular Connective Tissue

Cartilage Bone Adipose Tissue

Muscle Tissue Function provides organismic or organ movement organismic posture thermogenic Classification skeletal smooth cardiac

Muscle Tissue Skeletal Muscle Tissue Smooth Muscle Tissue Cardiac Muscle Tissue

Nervous Tissue Function converts environmental and internal stimuli into nerve impulses stimulates or inhibits cells or glands Classification neurons neuroglia (glia)

Neuron

Organ Systems