Why do we study DNA? DNA is the blueprint for life

The Central Dogma of Molecular Biology Genes code  protein  perform functions in the cell that results in a phenotype DNA  RNA  Protein Transcription Translation

Example of Phenotypes Created by Proteins Hair color Eye color Hair texture Blood type (A, B, O) Shoe size Eyelash length

How much DNA is in our body? Our DNA makes up 1% of our body weight, so a 150 lb. person would have 1.5 lbs. of DNA. In one cell – 3 meters of DNA. If you typed out your entire DNA sequence in Times 12pt font you would fill enough paper to reach the top of the Washington Monument in D.C.

How the Cell Stores DNA Double helix Nucleosomes DNA and histones Folds long strands of DNA Regulates what is expressed Chromatin – Packed DNA and histones (type of protein) Supercoils Chromosomes – most tightly packaged DNA Packaging Movie

I supercoiled myself into this box!

Chromosome Numbers Humans: 46 Mouse: 40 Dog: 78 Corn: 20 Ant: 2

The Structure of DNA Nucleotides DNA: DeoxyriboNucleic Acid Found in the nucleus Three subunits for each building block: Deoxyribose (5 carbon sugar) Phosphate Nitrogen Base (can be 1 of 4) Guanine Cytosine Adenine Thymine

Base Pair Matching The two strands are held together by hydrogen bonds. G and C – form 3 hydrogen bonds A and T – form 2 hydrogen bonds DNAtris

DNA Game The Double Helix James Watson, Francis Crick, and Maurice Wilkins were awarded the Nobel prize. Rosalie Franklin died before she could be awarded with the Nobel prize. Chargraff identified that G and C pair, and T and A pair.

DNA Replication Double helix must unzip H-bonds break Each original strand becomes a template strand (white) Bases fill in to form Complementary strands (black) DNA polymerase – building enzyme – adds new bases Occurs in the nucleus

fills in new nucleotide bases DNA Replication A-T T-A C-G G-C A- T- C- G- -T -A -G -C Enzyme (Helicase) Unzips DNA Workshop A- T- C- G- -T -A -G -C T A A G C A T T C G Enzyme (DNA Polymerase) fills in new nucleotide bases New Strands

RNA Structure RNA: RiboNucleic Acid Found in the nucleus (nucleolus) Can leave the nucleus Single stranded! Building blocks made of: Ribose (5 carbon sugar) Phosphate Nitrogen Base (1 of 4) Guanine Cytosine Adenine Uracil (Instead of Thymine)

Three Kinds of RNA Messenger RNA (mRNA) conveys genetic information to the rest of the cell Ribosomal RNA (rRNA) structural, part of ribosome Transfer RNA (tRNA) carries amino acids to site of protein synthesis

Transcription Occurs in the nucleus Animation Transcription Occurs in the nucleus RNA polymerase adds complementary nucleotides Forms from one of the DNA strands (template strand) RNA is a blue print for proteins

fills in new nucleotide bases DNA Workshop Transcription A- T- C- G- A-T T-A C-G G-C -T -A -G -C Enzyme Unzips Template Strand U A A G C Enzyme (RNA Polymerase) fills in new nucleotide bases RNA Strand

ATGTCGGACTCAGAAGTCAATCAAGAAGCTAAGCCAGAGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAATTTAAAGGTGTCCGATGGATCTTCAGAGATCTTCTTCAAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCGCTAAAAGACAGGGTAAGGAAATGGACTCCTAAGATTCTTGTACGACGGTATTAGAATTCAAGCTGATCAGACCCCTGAAGATTTGGACATGGAGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGTGGTGCTACGTATTAG Not all of this DNA sequence will make a protein, some of it is nonsense and some of it gives information about when the protein should be made.

The Genetic Code DNA is a code to make proteins Proteins: Made by Amino Acids There are 20 types of amino acids Each amino acid has it’s own special character.

Translation: mRNA to Protein Firefly Movie Think of each base as a letter (G, C, A, U) Three bases = “a word” Each “word” codes for an amino acid - codon Start codon - AUG Stop codons Many codons together make a gene Where does each step take place?

Forming Polypeptide Chain Translation Forming Polypeptide Chain Lysine tRNA mRNA Ribosome Location: ribosomes mRNA has codons (3 bases) tRNA carries an amino acid to the forming polypeptide (3 bases on tRNA - anti-codon) The anti-codons complement the codons in the mRNA Begins at start codons Ends at stop codons Codon

Translation Animation

TAC GGC TAT CCA

What Do Mutations Cause? What Causes Mutations? Carcinogens Radiation Viruses Heredity What Do Mutations Cause? Cancer Slight frequent changes = polymorphisms Genetic Diseases Cystic fibrosis (effects mucus production) Hemophilia (blood won’t clot) Sickle cell anemia

Mutations Point mutations (Substitutions) Original: The fat cat ate the wee rat. Point Mutation: The fat hat ate the wee rat. Frameshift mutations (Insertion, Deletion) Original: The fat cat ate the wee rat. Frame Shift: The fat caa tet hew eer at. Deletion Substitution Insertion

Gene Regulation Not all genes are expressed in every cell Not all genes are expressed at the same time. An operon is a group of genes that operate together A skin cell expresses different genes than a nerve cell Regulatory sites DNA strand Promoter Stop transcription Start transcription

Chapter Objectives Know the scientists involved with the discovery of the structure and function of DNA Know the structure and function of DNA. Know how DNA is packaged in the cell. Know how DNA is replicated. Know the structure and function of RNA. Know how RNA is made. Know the three types of RNA. Know how RNA makes proteins. Be able to go from a sequence of DNA to RNA to protein. Give examples of types of proteins and what they do. Differentiate between replication, transcription and translation. List, demonstrate, and identify types of mutations. Be able to discuss the potential outcomes of mutations.