Linkage and Mapping
Figure 4-8 For linked genes, recombinant frequencies are less than 50 percent
Map distances are generally additive
A map of the 12 tomato chromosomes Genetic distance is measured by recombination frequency A relative map can be constructed based on genetic distances
Genetic vs. Molecular Maps What is the relationship of genetic distance to molecular distance? How can genetic and molecular relationships be reconciled? How can one be used to locate the other?
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Genetic markers Genetic mapping between positions on chromosomes –Positions can be genes Responsible for phenotype –Examples: eye color or disease trait –Positions can be physical markers DNA sequence variation
Physical markers Physical markers are DNA sequences that vary between two related genomes Referred to as a DNA polymorphism Usually not in a gene –Examples SSLP (microsatellite) SNP –RFLP –Intergenic SNP –Silent intragenic SNP –Causative point mutation
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey SSLP Simple-sequence length polymorphism Most genomes contain repeats of three or four nucleotides Length of repeat varies Use PCR with primers external to the repeat region On gel, see difference in length of amplified fragment ATCCTACGACGACGACGATTGATGCT ATCCTACGACGACGACGACGACGATTGATGCT
RFLP Restriction-fragment length polymorphism –Cut genomic DNA from two individuals with restriction enzyme –Run Southern blot –Probe with different pieces of DNA –Sequence difference creates different band pattern GGATCC CCTAGG GGTACC CCATGG GGATCC CCTAGG GGATCC CCTAGG GCTACC CGATGG GGATCC CCTAGG * * ** 2 1 KpnI
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey SNP Single-nucleotide polymorphism –One-nucleotide difference in sequence of two organisms –Discovered by sequencing –Example: Between any two humans, on average one SNP every 1,000 base pairs ATCGATTGCCATGAC ATCGATGGCCATGAC 2 1 SNP
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Physical mapping Determination of physical distance between two points on chromosome –Distance in base pairs Example: between physical marker and a gene Need overlapping fragments of DNA –Requires vectors that accommodate large inserts Examples: cosmids, YACs, and BACs
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Large insert vectors Lambda phage –Insert size: 20–30 kb Cosmids –Insert size: 35–45 kb BACs and PACs (bacterial and P1 artificial chromosomes respectively) –Insert size: 100–300 kb YACs (yeast artificial chromosomes) –Insert size: 200–1,000 kb
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Pros and cons of large-insert vectors Lambda phage and cosmids –Inserts stable –But insert size too small for large-scale sequencing projects YACs –Largest insert size –But difficult to work with
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey BACs and PACs –Most commonly used vectors for large-scale sequencing –Good compromise between insert size and ease of use –Growth and isolation similar to that for plasmids
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Contigs Contigs are groups of overlapping pieces of chromosomal DNA –Make contiguous clones For sequencing one wants to create “minimum tiling path” –Contig of smallest number of inserts that covers a region of the chromosome genomic DNA contig minimum tiling path
Pros and cons whole genome shotgun sequencing Pros –Very rapid –Becomes cheaper as sequencing technologies advance Cons –Alignment is more challenging, especially in repeats –Requires more computing power
Figure 4-20 Phenotypic and molecular markers mapped on human chromosome 1
SNP genotyping methods Single SNPs: –SSCP –TGCE –Differential PCR amplification Many SNPs simultaneously: –SNP arrays –Direct sequencing (high-throughput)
Temperature gradient gel electrophoresis
Alignment of physical and recombination maps
Phase I (2005) 1M SNPs from 269 individuals Phase II (2007) 3M SNPs from 270 individuals Phase III (2010) 1.6M SNPs genotyped from 1184 individuals from 11 populations Sequenced 10x 100kb regions from 692
Figure 4-16 Using haplotypes to deduce gene position