Biotechnology
What is biotechnology? Biotechnology is formally defined as the science of using living things, and components of living things, to produce goods and services. It involves manipulating and modifying organisms, often at the molecular level, to create new and practical applications for agriculture, medicine and industry.
It isn’t new It is not new…Bread, fermented beverages and cheese are all products of biotechnology that have been around for thousands of years. Even selecting the best crops to plant can be considered an application of biotechnology.
Yeast and bacteria Bread, alcohol, yogurt and cheese all involve the action of micro-organism in their creation. Bread and alcohol use yeast, while yogurt use bacteria. Cheese is made using an enzyme called Rennin. Some cheese also contains molds.
Modern biotechnology Modern biotechnology generally refers to alterations carried out on the cell or molecular level. This new field of science began in the late 1970’s.
Bacteria gene splicing With an increased knowledge of genetics, scientists have been able to isolate individual genes on chromosomes. Using substances called restriction enzymes, geneticists have been able to cut out desired genes. They are then able to insert these desirable genes into a different organism.
What are restriction enzymes? These enzymes were discovered in bacteria. Each restriction enzyme recognizes a certain DNA sequence, and cuts it. For example: A restriction enzyme may recognize the sequence, “TTGG”. Everytime this “enzyme” sees this sequence, it cuts the strand between the T and the G This action turns a long strand of DNA into several smaller strands.
Example CGTTGGATTACATTGGCCGATATTGGAC If this strand is treated with our restriction enzyme that recognizes TTGG we would wind up with this. CGTT GGATTACATT GGCCGATATT GGAC Instead of one long strand, we know have 4 shorter strands.
Applications Geneticists can now use restriction enzymes to cut out useful genes and then insert them into another organisms DNA. The human gene for insulin can be cut out of the healthy cell and “spliced” the DNA of a bacteria. This new bacterial DNA is called “recombinant DNA”. Bacteria with recombinant DNA will now be able to produce Human insulin. This processes has saved the lives of literally millions of people suffering from diabetes.
Other applications Gene splicing has recreated recombinant DNA in many species. Some plants have been genetically altered to be pest and frost resistant. Scientists have also used gene splicing to create new animal genotypes and phenotypes. http://www.youtube.com/watch?v=n0UzdYRnMtY
Cloning Cloning is the creation of an organism that is genetically identical to another organism. Cloning in plants has been going on for thousands of years. Many plants make clones of themselves without any human intervention. In other cases, plants with desirable characteristics were cloned by taking a cutting from that plant and growing a new plant.
Animal cloning First attempted in 1950’s frogs, fish and mice were created. In these cases the DNA of non-differentiated embryonic cells was removed and placed into an egg cell. The failure rate was very high. Very few clones were created. Dolly the sheep was something different.
Somatic Cell Nuclear Transfer Or SCNT is the process by which the entire nucleus of an adult somatic cell is removed and placed into an egg cell that has its nucleus removed. This is the process used to create Dolly. http://www.youtube.com/watch?v=3TFF6Gbx8tk
Ethics and cloning. Since Dolly the sheep was cloned in 1998, many other mammals have been cloned in this manner. Cat and Dog owners have paid tens of thousands of dollars to create clones of their beloved pets. The technology exists so what about cloning humans?
Human cloning There are two main branches to consider. Theraputic cloning would involve the cloning of human cells for medical purposes. This type of cloning could lead to the treatment of such diseases as cancer and diabetes.
Reproductive cloning In this type of cloning an entire human being would be cloned creating a new individual. http://www.youtube.com/watch?v=7tbxN5uwaqA Can you think of arguments for human reproductive cloning? Can you think of arguments against human reproductive cloning?