Biotechnology.

Slides:



Advertisements
Similar presentations
Biotechnology Chapter 11.
Advertisements

Frontiers of Genetics.
Biotechnology Unit 3.04.
Genetic Engineering. Tools for Manipulating & Studying DNA  Restriction enzymes  Used to cut DNA where needed  PCR  Used to make multiple copies of.
Chapter 9: Biotechnology
Principles of Genetic Engineering. What is genetic engineering Genetic engineering, also known as recombinant DNA technology, means altering the genes.
Biotechnology & Genetic Engineering
Genetically Modified Organisms (GMOs)
KEY CONCEPT DNA sequences of organisms can be changed.
MILLER-LEVINE BIOLOGY BOOK
V Applications of Genetic Engineering. A. Transgenic Organisms –Transgenic Organisms An organism described as transgenic, contains genes from other species.
Chapter 13 It is the stuff of cartoons 1. Genetic engineering is the stuff of movies. Can you name a recent movie? 2.
Genetic Engineering Do you want a footer?.
 Transfer of gene/s from one organism to another/manipulation of DNA/modifying genes of organisms  Can involve gene transfer between organisms from.
Objective: Chapter 13- Biotechnology
A Look at Genetic Engineering and Biotechnology.
BIOTECHNOLOGY AND GENETIC ENGINEERING. BIOTECHNOLOGY A new field of science that uses organisms or their products to improve medicine, healthcare, and.
Genetic Engineering Regular Biology. Selective Breeding  This is the process of allowing those organisms with specific characteristics to reproduce 
Copyright Pearson Prentice Hall DNA Technology. Copyright Pearson Prentice Hall Selective Breeding Selective breeding allows only those organisms with.
End Show Slide 1 of 32 Copyright Pearson Prentice Hall Manipulating DNA.
Cloning What is a clone? An exact genetic copy. Offspring are produced asexually.
Agriscience Applications
DNA Manipulation Diabetes Genetic Engineering – Animals – Drugs Bacteria Plasmid Biopharming Transgenic Organisms Knockout Mice Cloning.
Human Cloning. Introduction Cloning- the process of making an identical organism through nonsexual means Cloning- the process of making an identical organism.
Biotechnology Plant and Soil Science Plant Science Technology Lesson 1 & 2.
Biotechnology the combination of biology and technology has been making many products better for many years. Products such as bread, cheese, and yogurt.
Cloning What is a clone? An exact genetic copy. Offspring are produced asexually.
Section 4-5 What is the future of evolution? Genetic Engineering.
9.4 Genetic Engineering KEY CONCEPT Genetic Engineering is about changing the DNA sequences of organisms.
1.What method would you guess forensic scientists use to identify criminals at crime scenes? 2.What do you think we mean by the term “biotechnology?” BELLRINGER-5/4/15.
Cloning and Genetic Engineering
Biotechnology Chapter 15. Biotechnology Historically, it is the use of organisms to perform a task or function In this sense, biotechnology has been used.
Modern Day Genetics.
GENETIC ENGINEERING Unit 6. What Animal is This?
BIOTECHNOLOGY AND GENETIC ENGINEERING. What is Biotechnology?  Biotechnology is the combination of biology and technology.  It has been making many.
KEY CONCEPT DNA sequences of organisms can be changed.
Introduction to Biotechnology. What is Biotechnology? Biotechnology is the manipulation of living organisms and organic material to serve human needs.
9.1 Manipulating DNA KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Aim #68: What are some applications of Genetic Engineering? Genetic Engineering is a process that is used to the alter the genetic instructions in organisms.
Genetic Engineering. Entire organisms can be cloned  Clone  a genetically identical copy of a gene or of an organism  Cloning occurs in nature:  Bacteria.
Biotechnology & Genetic Engineering Advanced Animal Science Chapter 10 Mrs. Balmer.
BIOTECHNOLOGY Gene Sequencing (Human Genome Project) Cloning Stem Cell Research Gene Therapy DNA Fingerprinting (and other Forensics applications)
Genetically Modified Organisms (GMOs)
Bioethics Writing Assignment
DNA Technology.
Chapter 9: Biotechnology
Aim: What are some applications of Genetic Engineering?
Plant and Soil Science Plant Science Technology Lesson 1 & 2
15.1 Selective Breeding and 15.2 Recombinant DNA
Understanding the Application
Genetic Engineering 9/11/2018 SB2f.
Genetic Engineering The simple addition, deletion, or manipulation of a single trait in an organism to create a desired change.
Biotechnology Genetic Engineering.
Understanding the Application
13–4 Applications of Genetic Engineering
KEY CONCEPT DNA sequences of organisms can be changed.
New genes can be added to an organism’s DNA.
1.
Genetic Engineering, Stem Cells, and Cloning
Scientists use several techniques to manipulate DNA.
Applications of Genetic Engineering
Biotechnology Jan. 05, 2016.
KEY CONCEPT DNA sequences of organisms can be changed.
DNA Manipulation Diabetes Genetic Engineering Bacterial Plasmid
KEY CONCEPT DNA sequences of organisms can be changed.
Understanding the Application
KEY CONCEPT DNA sequences of organisms can be changed.
Biotechnology Genetic Engineering
KEY CONCEPT DNA sequences of organisms can be changed.
KEY CONCEPT DNA sequences of organisms can be changed.
Presentation transcript:

Biotechnology

What is biotechnology? Biotechnology is formally defined as the science of using living things, and components of living things, to produce goods and services. It involves manipulating and modifying organisms, often at the molecular level, to create new and practical applications for agriculture, medicine and industry.

It isn’t new It is not new…Bread, fermented beverages and cheese are all products of biotechnology that have been around for thousands of years. Even selecting the best crops to plant can be considered an application of biotechnology.

Yeast and bacteria Bread, alcohol, yogurt and cheese all involve the action of micro-organism in their creation. Bread and alcohol use yeast, while yogurt use bacteria. Cheese is made using an enzyme called Rennin. Some cheese also contains molds.

Modern biotechnology Modern biotechnology generally refers to alterations carried out on the cell or molecular level. This new field of science began in the late 1970’s.

Bacteria gene splicing With an increased knowledge of genetics, scientists have been able to isolate individual genes on chromosomes. Using substances called restriction enzymes, geneticists have been able to cut out desired genes. They are then able to insert these desirable genes into a different organism.

What are restriction enzymes? These enzymes were discovered in bacteria. Each restriction enzyme recognizes a certain DNA sequence, and cuts it. For example: A restriction enzyme may recognize the sequence, “TTGG”. Everytime this “enzyme” sees this sequence, it cuts the strand between the T and the G This action turns a long strand of DNA into several smaller strands.

Example CGTTGGATTACATTGGCCGATATTGGAC If this strand is treated with our restriction enzyme that recognizes TTGG we would wind up with this. CGTT GGATTACATT GGCCGATATT GGAC Instead of one long strand, we know have 4 shorter strands.

Applications Geneticists can now use restriction enzymes to cut out useful genes and then insert them into another organisms DNA. The human gene for insulin can be cut out of the healthy cell and “spliced” the DNA of a bacteria. This new bacterial DNA is called “recombinant DNA”. Bacteria with recombinant DNA will now be able to produce Human insulin. This processes has saved the lives of literally millions of people suffering from diabetes.

Other applications Gene splicing has recreated recombinant DNA in many species. Some plants have been genetically altered to be pest and frost resistant. Scientists have also used gene splicing to create new animal genotypes and phenotypes. http://www.youtube.com/watch?v=n0UzdYRnMtY

Cloning Cloning is the creation of an organism that is genetically identical to another organism. Cloning in plants has been going on for thousands of years. Many plants make clones of themselves without any human intervention. In other cases, plants with desirable characteristics were cloned by taking a cutting from that plant and growing a new plant.

Animal cloning First attempted in 1950’s frogs, fish and mice were created. In these cases the DNA of non-differentiated embryonic cells was removed and placed into an egg cell. The failure rate was very high. Very few clones were created. Dolly the sheep was something different.

Somatic Cell Nuclear Transfer Or SCNT is the process by which the entire nucleus of an adult somatic cell is removed and placed into an egg cell that has its nucleus removed. This is the process used to create Dolly. http://www.youtube.com/watch?v=3TFF6Gbx8tk

Ethics and cloning. Since Dolly the sheep was cloned in 1998, many other mammals have been cloned in this manner. Cat and Dog owners have paid tens of thousands of dollars to create clones of their beloved pets. The technology exists so what about cloning humans?

Human cloning There are two main branches to consider. Theraputic cloning would involve the cloning of human cells for medical purposes. This type of cloning could lead to the treatment of such diseases as cancer and diabetes.

Reproductive cloning In this type of cloning an entire human being would be cloned creating a new individual. http://www.youtube.com/watch?v=7tbxN5uwaqA Can you think of arguments for human reproductive cloning? Can you think of arguments against human reproductive cloning?