The Suprachiasmatic Nucleus (SCN)

Slides:

Advertisements

Similar presentations

Hypothalamus. Older part of the brain (Primitive) –Maintenance of homeostasis Reception of external and internal signals Incorporation of signals to generate.

Advertisements

Biological rhythms. Types of biological rhythms what do we call rhythm in a living organism? – physiological events occurring at approximately regular.

Biology 2672a Biological Clocks. Biological Rhythms.

Circadian Biology Background, quantitative analysis, and present research.

By Dr. Nathaniel J. Kingsbury Friday, October 24, 2014, 10:00 a.m. Southwick Hall, Room 401.

Biological Rhythms. Biological Rhythms – terms and characteristics Rate of activity Time Amplitude – magnitude of change in the activity Period – time.

ACAMPROSATE IMPLANTATION INTO REWARD AREAS TO SUPPRESS ETHANOL REWARD AND RESTORE NORMAL CIRCADIAN ACTIVITY HAS DIFFERENTIAL EFFECTS IN WILD-TYPE AND HOMOZYGOUS.

Circadian rhythms Basic Neuroscience NBL 120 (2008)

MCB 186 CIRCADIAN BIOLOGY The cellular-molecular mechanism of the circadian clock CLOCK MUTANTS Lecture #4 October 18, 2006 J. W. Hastings.

Comparison of Wildtype vs. FASPS Mammalian Molecular Clocks By Erin Eppler May 2010

Modeling the mammalian circadian clock – intracellular feedback loops and synchronization of neurons Hanspeter Herzel Institute for Theoretical Biology.

Horacio de la Iglesia Department of Biology

Gap Junctions in the SCN YiDing Yu MCB 186 Circadian Biology.

Physiological roles and pharmacological effects of melatonin HMS BWH Frank A.J.L. Scheer, Ph.D. Division of Sleep Medicine Harvard Medical School Brigham.

MCB 186 CIRCADIAN BIOLOGY Slides Lecture 3 Clock genes & Biochemical Mechanisms October 5, 2005 J. W. Hastings.

Circadian Photoreception in Mammals MCB 186: Circadian Biology

MCB 186 CIRCADIAN BIOLOGY Lecture 4 Drugs as probes of mechanism: Phase shifts v.s. effects on period And some basic questions October 12, 2005 J. W. Hastings.

Tracing the ultimate timekeeper: Pathways involving the mammalian suprachiasmatic nucleus Lianne K. Morris-Smith NS&B2754/26/2005.

CLOCKS. Clocks: What is a clock? How does a biological clock compare with a mechanical clock? Why have a circadian clock? What are the properties of circadian.

Biological clocks Clock periods Clock mechanisms Circannual

Biological clocks Clock periods –Circannual –Circalunidian –Circadian Clock mechanisms –Entrainment –Neural location –Genetic basis.

The sun; SOHO's EIT (Extreme-Ultraviolet Imaging Telescope)

Disrupting Circadian rhythms Jet Lag and Shift Lag Aims To know the symptoms of Jet Lag To understand the effects of jet lag upon biological rhythms To.

Neurobiology of Circadian Rhythms Daniel J. Buysse, M.D. Professor of Psychiatry University of Pittsburgh School of Medicine Pittsburgh.

Biological dynamics  Dynamics = how systems change/evolve with time  Why are dynamics important to biological systems?  Temporal behavior of proteins,

ID (Cognition) Term Presentation, Fall’13 Sandipan Dasgupta,10-MS-12 4 th Year UG, Department of Biological Sciences.

Biological Rhythms: Circadian rhythms Aims To know the biological clock in control of the Circadian Rhythm To understand the difference between Endogeous.

CIRCADIAN RHYTHMS

Using the Laptops…  Follow the instructions on page 6 of your workbook.

Time-keeping System: Circadian Rhythms Helena Illnerová Institute of Physiology Academy of Sciences of the Czech Rep.

Disrupting circadian rhythms can have consequences When external cues change, we have to re- adjust our internal clock (and cycles) Jet lag…adaptation:

Circadian Rhythms Circa: from the Latin for “about” and Diem: From the Latin for “day”

Circadian Rhythms: Lecture 4 Proseminar in Biological Psychology

BIOLOGICAL RHYTHMS Neuroendocrine control: homeostatic responses and biological rhythms. A role for anticipation or feed-forward mechanisms or scheduled.

Topic 12 – Rhythms, Stress, and Associated Hormones.

From Zigmond et al Fundamental Neuroscience, AP 1999 The Big PICTURE: influence of the SCN timing system on various functions.

Lecture 9 NRS201S John Yeomans

Chapter 5: Consciousness Body Rhythms & Mental States.

Animal Behavior Hormones and Neurons. What are hormones? In animals... Molecules that circulate in blood Bind to receptors Cause something to happen i.e.,

Taattcgcggccgcttctagagattgtgagcggataacaattgacattgtgagcggataacaagatactgagcactactagagaaagaggagaaatactagatgactataatgataaaaaaat cggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactc.

Tidal rhythms (periods ~ 12.4 hours) fiddler crab foraging.

Light →SCN: -direct via the retinohypothalamic (RHT) pathway -indirect via geniculohypothalamic (GHT) pathway.

Biorhythm From Wikipedia, the free encyclopedia

Taking Neuroscience into the classroom Community Connection.

Biological clock An innate mechanism in living organisms that controls the periodicity or rhythm of various physiological functions or activities. Circadian.

Entrainment of randomly coupled oscillator networks Hiroshi KORI Fritz Haber Institute of Max Planck Society, Berlin With: A. S. Mikhailov 

THE PHYSIOLOGICAL AND BEHAVIORAL CORRELATES OF SLEEP AND DREAMING

Do Per1 and Per2 respond differentially to photoperiod in individual SCN neurons? Jocelyn Rice MCB186 Final Project December 13, 2006.

Intro to Biological rhythms and Sleep (PSYA3). Objectives Describe 3 types of Biological Rhythms and give examples. Explain how Endogenous pacemakers.

MCB 186 CIRCADIAN BIOLOGY Biochemistry of the Circadian Clock Lecture #3 October 3, 2007 J. W. Hastings.

Hypothalamus BLOCK 3 – Robert R. Terreberry, PhD Room 142 Ph

By: Jeffery Jarmusik and Andrew McCurrach

Neuronal Control of Behavior

SCN lesion abolished ultradian rhythms at < 24 h

Behaviors Governed by circadian & Circannual rhythm

Michael W Young Trends in Biochemical Sciences

Lisa Lyons Biological Science

Regulation of melatonin production and receptor function.

Ez and EP recap.

Circannual Clocks: Annual Timers Unraveled in Sheep

Chapter 49 Nervous Systems.

Volume 19, Issue 1, Pages (July 1997)

Circadian Timing of REM Sleep Is Coupled to an Oscillator within the Dorsomedial Suprachiasmatic Nucleus Michael L. Lee, Beryl E. Swanson, Horacio O.

Seasonal Encoding by the Circadian Pacemaker of the SCN

In Vivo Monitoring of Circadian Timing in Freely Moving Mice

Hypothalamic clocks and rhythms in feeding behaviour

Jing Zhang, Zhe Fang, Corinne Jud, Mariska J

Three period Homologs in Mammals: Differential Light Responses in the Suprachiasmatic Circadian Clock and Oscillating Transcripts Outside of Brain Mark.

Presentation transcript:

The Suprachiasmatic Nucleus (SCN) A Mammalian Pacemaker Joshua Gooley MCB 186: Circadian Biology October 19, 2005

The SCN is located in the anterior hypothalamus Krieg, 1932

Location of the SCN in Human Moore, 1991

The SCN receives direct retinal input Hendrickson et al., 1972 Moore and Lenn, 1972

SCN lesions eliminate corticosteroid rhythm Moore, 1972

SCN lesions disrupt circadian rhythms Drinking Rhythm Enucleated SCN-X 12 24 12 24 Body Temperature Locomotor Activity Sham SCN-X Sham SCN-X Stephan and Zucker, 1972; Kittrell, 1988

SCN lesions block circadian rhythm of sleep Solid line: Sham Dashed line: SCN-X Ibuka et al., 1977

The SCN is shows diurnal rhythm of glucose utilization 0900 2100 DG Nissl Lights on: 0600-1800 Schwartz and Gainer, 1977

Circadian rhythm of electrical activity persists in the SCN isolated in vivo – the “SCN island experiment” Inouye and Kawamura, 1979

Circadian rhythms measured in hypothalamic slices Martha Gillette Multiunit electrical activity Vasopressin Release

The Tau hamster displays a short circadian period Normal Heterozygous Homozygous mutant Ralph and Menaker

Circadian period is genetically encoded in the SCN Ralph et al., 1990

Individual SCN neurons show circadian rhythm of electrical activity and display different periods Welsh et al., 1995

Light- and circadian-regulated expression of clock genes in the SCN Antle and Silver, 2005 Dunlap, 1999

The SCN determines the circadian phase of behavior de la Iglesia, 2000

Individual SCN neurons show circadian expression of Per1 in hypothalamic slices Per1-luciferase rhythm in individual SCN neurons Circadian rhythm of Per1 In four SCN neurons Wild Type: Per1 circadian rhythm is robust in individual SCN neurons Double Cry knockout: Per1 rhythm is lost in individual SCN neurons Yamaguchi et al., 2003

Many genes are under circadian regulation in the SCN with broadly distributed circadian phases Panda et al., 2002

The SCN is heterogeneously organized Gooley and Saper, 2004 Karatsoreos et al., 2004

The SCN is functionally subdivided Antle and Silver, 2005

VIP signaling is required for circadian expression of behavioral rhythms Harmar et al., 2004

Inputs to the Suprachiasmatic Nucleus Gooley and Saper, 2004

The intergeniculate leaflet and median raphe nucleus project to the suprachiasmatic nucleus IGL (retros from SCN) MRN (5-HT) MRN (retros from SCN) Morin et al., 2004; Leander et al., 1998

Circadian entrainment by exogenous melatonin Melatonin binding in SCN Weaver, 1991 Cassone et al., 1996

Efferent projections of the Suprachiasmatic Nucleus Gooley and Saper, 2004

Circadian outflow pathways from the SCN Saper et al., 2005

Diffusible factors can regulate behavioral rhythms Polymer-encapsulated SCN graft Silver et al., 1996

EGF receptor signaling can regulate behavior Kramer et al., 2001

Prokineticin 2 inhibits behavioral activity saline PK2 Cheng et al., 2002

The SCN is a light entrainable circadian clock… Behavior Physiology …but it is not the only circadian clock