BACKGROUND In vitro steady-state transcription of DNA fragments each containing a single promoter revealed an extraordinarily high degree of abortive initiation (1-3) and low level of promoter escape. The latter signals the completion of the initiation-elongation transition and the polymerase can move away from the promoter region to produce a full-length RNA. For T5 N25 -- an E. coli E  70 promoter that is rate-limited at the escape step of initiation (1, 4), changing the initial transcribed sequence (ITS; from +3 to +20) greatly altered the abortive- productive transcription properties. Thus, depending on the ITS adapted to it, N25 promoter variants will undergo different degrees of repetitive abortive initiation to produce distinct collections of abortive RNA with characteristic abortive potentials, and their productive efficiency fluctuates by ~25 fold. Previous results raise two issues concerning abortive initiation and promoter escape. First, the seemingly wasteful nature of the abortive transcription process begs the question of the physiological relevance of this observation. To address this issue, we examined the dependence of abortive-productive transcription from four N25-ITS promoters on template conformation – an important factor that differentiates in vitro versus in vivo transcription. Second, the four ITS sequences gave large variations in abortive-productive transcription. We surmised that this variation might result from at least two changes induced by the different ITS: one, the kinetics of the promoter escape process, and two, the partitioning of RNA polymerase – promoter DNA complexes into productive or unproductive fractions (2). Both changes could be measured by performing single-cycle kinetic analysis under polymerase-limiting conditions.

EXPERIMENTAL SETUP Single-cycle templates: N25(-C): AUAAAUUUGAGAGAGGAGUUUAAAUAUGGC +30 N25anti(-A): GUCCGGCGUCCUCUUCCCGGUCCGUCUGGCUGGUUCUGCA +41 N25/A1(-U): ACCGAGAGGGACACGGCGAAGAGCAAGCCCAAU +33 N25/A1anti(-G): AUAUCUCUUUCACAUUAUCCUAUCCAUCCCAAUCG +35 Template Conformations: PS: short PCR fragment of 142 bp spanning -85 to +57 PL: long PCR fragment of 348 bp spanning -234 to +114 LN: plasmid DNA linearized such that the promoter is centrally situated SC: 3338-bp supercoiled plasmid DNA Reaction Conditions:  Single-cycle transcription was achieved through withholding one of the 4 NTP’s and supplementing the 3’-deoxy form of the 4th NTP.  Open complexes were formed first under polymerase-limiting conditions (40 nM DNA, 20 nM RNAP) in 1x trxn buffer/200 mM KCl for 37 o C.  An equal volume of a 2x NTP mix (in buffer/KCl) was added to commence the time course. The final [NTP] for each template is as follows.  N25(-C): 20  M [  - 32 P]UTP, 100  M A/G/3’-dCTP; N25anti(-A): 20  M [  - 32 P]UTP, 100  M G/C/3’-dATP; N25/A1(-U): 20  M [  - 32 P]CTP, 100  M A/G/3’-dUTP; N25/A1anti(-G): 20  M [  - 32 P]UTP, 100  M A/C/3’-dGTP

Template supercoiling greatly enhances the efficiency of promoter escape during steady-state transcription.

Rate Diagram of Transcription Initiation During single-cycle transcription under polymerase limitation, every RNAP will bind to the N25 promoter and becomes partitioned into either the productive (RP o ) or unproductive (RP o ’) open complex. The productive complexes can proceed through escape to give rise to full-length RNA (FL). The kinetics of FL synthesis all fit a single exponential rise equation [y = m1 + m2*(1-exp(-m3*x) where m1 = 0], allowing us to extract k E (m3), the composite rate constant of escape, as well as the plateau level of FL (m2, in fmoles) which reflects the productive fraction. Dividing k E into ln2 yields t 1/2, the half-life of escape.

Typical gel profiles H: the LN conformation of all four promoter templates V: N25anti(-A) in SC, LN, or PL conformation

Time-course experiments were performed 3 to 5 times for each promoter in a given template conformation. The average values of t 1/2 and plateau level are summarized in Table 1 below.

The initial transcribed sequence drastically alters the rate of escape, in a template conformation-dependent manner.

Additional observations:  Negative supercoiling greatly stimulates the rate of escape at every promoter. Why? We surmise that the increasingly underwound transcription bubble is better accommodated in the supercoiled conformation, without triggering backtracking. In turn, the expanded transcription bubble generates a rewinding tension that causes upstream bubble collapse, leading to escape.  GreB usually further enhances the rate of escape. The effect of GreB is more pronounced on the slow-escaping anti promoters (by 2-3 fold). The extent of stimulation is probably in proportion to the amount of the backtracked (abortive) complexes formed at these promoters (see gels).

Partitioning of RNA polymerase into the productive fraction is altered by the ITS but unaffected by GreB.

Additional observations:  Partitioning shows unpredictable patterns of dependence on template conformation. For three of the four promoters, partitioning into the productive fraction is stimulated by supercoiling.  Interestingly, the anti promoters that show a slow rate of escape formed a higher fraction of productive complexes than promoters containing the “native” ITSs. This observation was unexpected from the low level of productive transcription by the anti promoters in steady-state assays.  Importantly, under single-cycle and polymerase limiting conditions, GreB showed no stimulatory effect on polymerase partitioning on most N25-derived promoters, except for N25 anti (-A), where the effect -- depending on the conformation of the promoter -- is less than 2 fold.

R 2 = 0.99 R 2 = 0.98 R 2 = 0.97 R 2 = 0.99 Time (sec) IQV The synthesis of abortive RNAs all showed a time course of single exponential rise.

Analysis of t 1/2 and plateau level reveals the unproductive ITCs of N25anti(-A) to be “stuck” at C7 in the PL conformation.

Implications from the kinetics of abortive RNA synthesis:  On N25 anti (-A) promoter in the PL conformation, RNAP molecules clearly partitioned into the productive and unproductive fractions.  Judging by the half-life of synthesis and the plateau level of each abortive RNA, the unproductive ITCs are comprised of complexes that are unable to proceed beyond the C7 stage. At this stage, the nascent transcript clashes with the  3.2 linker loop (5). To proceed beyond, the nascent RNA presumably has to displace the linker loop from the RNA exit channel.  The C7 block is greatly diminished when the template is in the LN or SC conformation. This suggests that the partitioning into the productive/ unproductive ITCs is dependent on template conformation.  Abortive RNAs longer than C7 all showed t 1/2 ’s comparable to that of FL, suggesting that these abortive RNAs were all released by the productive complexes on their way to escape and FL RNA synthesis.

Conclusions: 1. On N25-ITS promoters, the initial transcribed sequence dictates the rate of escape. The ITSs that are purine-rich in the NT strand showed fast rate of escape, whereas the pyrimidine-rich anti ITSs gave very slow rate of escape. 2. To a smaller extent, the initial transcribed sequence also influences the partitioning of polymerase into the productive vs. unproductive fractions. Interestingly, the ITSs that gave slow escape supported the formation of a higher fraction of productive complexes, and vice versa. This was unexpected. 3. Negative supercoiling greatly enhances the rate of escape, and possibly also contributes to polymerase partitioning into the productive fraction. 4. GreB facilitates escape from the N25 promoters mainly by stimulating the rate of escape, and not by influencing the partitioning of the polymerase into the productive vs. unproductive fractions as proposed for other promoters (6). 5. By analyzing the kinetics of synthesis of abortive and FL RNAs, we have elucidated the nature of the unproductive ITCs on N25 anti (-A) promoter. We further found that the fraction of unproductive ITCs varies with the conformation of the promoter template.

References: 1. Hsu, L. M. et al. (2006) Biochemistry 45, Vo, N. V. et al. (2003) Biochemistry 42, Hsu, L. M. et al. (2003) Biochemistry 42, Knaus, R. and Bujard, H. (1990) Nucleic Acids and Molecular Biology 4, Kulbachinskiy, A. and Mustaev, A. (2006) J. Biol. Chem. 281, Susa, M. et al. (2006) Mol. Microbiol. 59, Acknowledgment This work was funded by an NSF-RUI grant (MCB ) to LMH.