Basics of RNA structure. RNA functions Storage/transfer of genetic information Genomes many viruses have RNA genomes single-stranded (ssRNA) e.g., retroviruses.

Slides:

Advertisements

Similar presentations

17P2-1 Chapter 17: Outline DNA Mutation Chromosomes and Variations Chromatin SupercoilingGenome Structure RNA (We are here.) Transfer, Ribosomal, Messenger.

Advertisements

Molecular Genetics DNA RNA Protein Phenotype Genome Gene

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.

Protein Synthesis Ordinary Level. Lesson Objectives At the end of this lesson you should be able to 1.Outline the steps in protein synthesis 2.Understand.

Cell Protein Production

Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 3 Cell Structures and Their Functions Dividing Cells.

Chapter 8 Sandra Loranger Stacie Daer Mike Reilly.

RNA and Protein Synthesis

Translation (Protein Synthesis) RNA  protein. Making a protein Many RNAs needed –mRNA, tRNA, rRNA.

Gene expression.

PROTEIN SYNTHESIS.

DNA: Transcription & Translation How do we go from DNA to PROTEIN?

RNA Processing. RNA, ribonucleic acid single strand polymers of ribonucleotides have secondary and tertiary structure.

AP Biology Protein Synthesis Part 1. . Amino group Carboxyl group  carbon.

Transcription and Translation

13.2 Ribosomes and Protein Synthesis

RNA & Protein Synthesis. DNA Determines Protein Structure The genetic information that is held in the molecules of DNA ultimately determines an organism’s.

Function of RNA Since DNA cannot leave the nucleus, RNA molecules will convert the written instructions into proteins in the cytoplasm Genes are coded.

RNA Tertiary Structure. Additional Motifs of Tertiary Structure Coaxial helix A minor motif Pseudoknots Tetraloops Loop-loop Ribose zipper Kink turn motif.

RNA uses the sugar ribose instead of deoxyribose in its backbone.

The Genetic Code.

CFE Higher Biology DNA and the Genome Translation.

Protein Synthesis Involves RNA (base change of uracil for thyamine, single small strand and less stable than DNA). Three types of RNA – messenger (mRNA),

RNA and Protein Synthesis

REVIEW. Protein Synthesis AT-A-GLANCE Translation.

Unit Three “Cell Proliferation and Genetics” “Protein Synthesis”

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

3.A.1 DNA and RNA Part IV: Translation DNA, and in some cases RNA, is the primary source of heritable information. DNA, and in some cases RNA, is the primary.

Structure and functions of RNA. RNA is single stranded, contains uracil instead of thymine and ribose instead of deoxyribose sugar. mRNA carries a copy.

RNA By PresenterMedia.com PresenterMedia.com. DNA is located in the nucleus of eukaryotic cells A strand of DNA is moved from the nucleus out into the.

Protein Synthesis: Transcription & Translation.

Functions of RNA mRNA (messenger)- instructions protein

RNA Makin’ Proteins DNAMutations Show off those Genes!

Chapter 12-3: RNA & Protein Synthesis Essential Questions:  What are 3 types of RNA?  What is the function of 3 types of RNA?  What happens during transcription?

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

RNA Very similar to DNA. Exceptions: - Ribose is the 5-carbon sugar - Uracil replaces thymine - Single-stranded.

Protein Synthesis Who am I? How was I formed? Where’s my mom? A molecular model of the YiiP zinc transporter protein with bound zinc ions (red spheres).

Chapter  Relate the concept of the gene to the sequence of nucleotides in DNA  Sequence the steps involved in protein synthesis ◦ DNA  mRNA =

Biochemistry Free For All

Basics of RNA structure and modeling

Molecular Genetics Transcription & Translation

Biochemical Organization & functions of RNA

Protein Synthesis Part 3

Gene Expression Continued

RNA and Protein Synthesis

RNA and Protein Synthesis

RNA and Protein Synthesis

Bellwork: How does a cell interpret the genetic code

Old News TRANSCRIPTION: process that makes an _______ ___________ of DNA. RNA is ________________, and ___ is replaced by ___ (A-U; G-C) RNA___________________.

Protein Synthesis Part 3

Concept 17.3: Eukaryotic cells modify RNA after transcription

Protein Synthesis Part 3

Transcription -The main purpose of transcription is to create RNA from DNA because RNA leaves the nucleus to carry out its functions but DNA does not -A.

Protein Synthesis Step 2: Translation

RNA and Protein Synthesis

Translation (Protein Synthesis) RNA  protein.

Protein Synthesis Miss Richardson SBI4U.

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

12.2 DNA Replication Process of creating an identical copy of DNA is replication. 2 strands will unwind and become a template for copying. strands separate.

Protein Synthesis.

RNA and Protein Synthesis

RNA - TRANSLATION.

RNA, Ribosomes, And Protein synthesis

Proteins: Building Blocks of Life

Nucleic Acid Molecules -DNA, RNA and ATP -Structure and Functions

RNA and Transcription CENTRAL DOGMA

Protein Synthesis: An Overview

Protein Synthesis.

Presentation transcript:

Basics of RNA structure

RNA functions Storage/transfer of genetic information Genomes many viruses have RNA genomes single-stranded (ssRNA) e.g., retroviruses (HIV) double-stranded (dsRNA) Transfer of genetic information mRNA = "coding RNA" - encodes proteins

RNA functions Structural e.g., rRNA, which is a major structural component of ribosomes BUT - its role is not just structural, also: Catalytic RNA in the ribosome has peptidyltransferase activity Enzymatic activity responsible for peptide bond formation between amino acids in growing peptide chain Also, many small RNAs are enzymes "ribozymes"

RNA functions Regulatory Recently discovered important new roles for RNAs In normal cells: in "defense" - esp. in plants in normal development e.g., siRNAs, miRNA As tools: for gene therapy or to modify gene expression RNAi RNA aptamers Aptamers : are oligonucleic acid that bind to a specific target molecule.oligonucleic acid

RNA types & functions Types of RNAsPrimary Function(s) mRNA - messengertranslation (protein synthesis) regulatory rRNA - ribosomaltranslation (protein synthesis) t-RNA - transfertranslation (protein synthesis) hnRNA - heterogeneous nuclearprecursors & intermediates of mature mRNAs & other RNAs scRNA - small cytoplasmicsignal recognition particle (SRP) tRNA processing snRNA - small nuclear snoRNA - small nucleolar mRNA processing, poly A addition rRNA processing/maturation/methylation regulatory RNAs (siRNA, miRNA, etc.) regulation of transcription and translation, other??

Types of RNA Genetic information copied from DNA is transferred to 3 types of RNA: __________ RNA: mRNA Copy of information in DNA that is brought to the ribosome and translated into PROTEIN by tRNA & rRNA. ( 2%), 100,000 KINDS. __________ RNA: rRNA Most of the RNA in cells is associated with structures known as ribosomes, the protein factories of the cells.(80%), FEW KINDS It is the site of translation where genetic information brought by mRNA is translated into actual proteins. ___________ RNA: tRNA Brings the amino acid to the ribosome that mRNA coded for. (15%), 100 KINDS.