9/14/2015BCHB Edwards Introduction to Python BCHB Lecture 4

9/14/2015BCHB Edwards Outline Review Homework #1 Notes Control flow: if statement Control flow: for statement Exercises 2

9/14/2015BCHB Edwards Review Printing and execution Variables and basic data-types: integers, floats, strings Arithmetic with, conversion between String characters and chunks, string methods Functions, using/calling and defining: Use in any expression Parameters as input, return for output Functions calling other functions (oh my!) If statements – conditional execution 3

Homework #1 Notes Python programs: Upload.py files Don't paste into comment box Don't paste into your writeup Writeup: Upload.txt files, Don't paste into comment box Text document preferred 9/14/2015BCHB Edwards4

Homework #1 Notes Multiple submissions: OK, but… …I'll ignore all except the last one Make each (re-)submission complete Grading: Random grading order Comments Grading "curve" 9/14/2015BCHB Edwards5

Control Flow: if statement Execution path depends on string in seq. Make sure you change seq to different values. 9/14/2015BCHB Edwards # The input DNA sequence seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg' # Remove the initial Met codon if it is there if seq.startswith('atg'): print "Sequence without initial Met:",seq[3:] else: print "Sequence (no initial Met):",seq 6

Control Flow: if statement 9/14/2015BCHB Edwards # The input DNA sequence seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg' # Remove the initial Met codon if it is there if seq.startswith('atg'): initMet = True newseq = seq[3:] else: initMet = False newseq = seq # Output the results print "Original sequence:",seq print "Sequence starts with Met:",initMet print "Sequence without initial Met:",newseq 7

Control Flow: if statement 9/14/2015BCHB Edwards # The input DNA sequence seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg' # Remove the initial Met codon if it is there initMet = seq.startswith('atg'): if initMet: newseq = seq[3:] else: newseq = seq # Output the results print "Original sequence:",seq print "Sequence starts with Met:",initMet print "Sequence without initial Met:",newseq 8

Control Flow: if statement 9/14/2015BCHB Edwards # The input DNA sequence seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg' # Remove the initial Met codon if it is there initMet = seq.startswith('atg') if initMet: seq = seq[3:] # Output the results print "Sequence starts with Met:",initMet print "Sequence without initial Met:",seq 9

Serial if statement 9/14/2015BCHB Edwards # Determine the complementary nucleotide def complement(nuc): if nuc == 'A': comp = 'T' if nuc == 'T': comp = 'A' if nuc == 'C': comp = 'G' if nuc == 'G': comp = 'C' return comp # Use the complement function print "The complement of A is",complement('A') print "The complement of T is",complement('T') print "The complement of C is",complement('C') print "The complement of G is",complement('G') 10

Compound if statement 9/14/2015BCHB Edwards # Determine the complementary nucleotide def complement(nuc): if nuc == 'A': comp = 'T' elif nuc == 'T': comp = 'A' elif nuc == 'C': comp = 'G' elif nuc == 'G': comp = 'C' else: comp = nuc return comp # Use the complement function print "The complement of A is",complement('A') print "The complement of T is",complement('T') print "The complement of C is",complement('C') print "The complement of G is",complement('G') 11

If statement conditions Any expression (variable, arithmetic, function call, etc.) that evaluates to True or False Any expression tested against another expression using: == (equality), != (inequality) < (less than), <= (less than or equal) > (greater than), >= (greater than or equal) in (an element of) Conditions can be combined using: and, or, not, and parentheses 9/14/2015BCHB Edwards12

Sequential/Iterative execution Note use of indentation to define a block! 9/14/2015BCHB Edwards13 For (each) statements # Print the numbers 0 through 4 for i in range(0,5): print i # Print the nucleotides in seq seq = 'ATGGCAT' for nuc in seq: print nuc

9/14/2015BCHB Edwards14 For (each) statements # Input to program seq = 'AGTAGTTCGCGTAGCTAGCTAGCTATGCG' # Examine each symbol in seq and count the A's count = 0 for nuc in seq: if nuc == 'A': count = count + 1 # Output the result print "Sequence",seq,"contains",count,"A symbols"

9/14/2015BCHB Edwards15 For (each) statements # Examine each symbol in seq and count the A's def countAs(seq): count = 0 for nuc in seq: if nuc == 'A': count = count + 1 return count # Input to program inseq = 'AGTAGTTCGCGTAGCTAGCTAGCTATGCG' # Compute count aCount = countAs(inseq) # Output the result print "Sequence",inseq,"contains",aCount,"A symbols"

9/14/2015BCHB Edwards16 For (each) statements # Examine each symbol in seq and count those that match sym def countSym(seq,sym): count = 0 for nuc in seq: if nuc == sym: count = count + 1 return count # Input to program inseq = 'AGTAGTTCGCGTAGCTAGCTAGCTATGCG' # Compute count aCount = countSym(inseq,'A') # Output the result print "Sequence",inseq,"contains",aCount,"A symbols"

Exercise 1 Write a Python program to compute the reverse complement of a codon Use my solution to Homework #1 Exercise #1 as a starting point Add the “complement” function of this lecture (slide 12) as provided. Modularize! Place the reverse complement code in a new function. Call the new function with a variety of codons Change the complement function to handle upper and lower-case nucleotide symbols. Test your code with upper and lower-case codons. 9/14/2015BCHB Edwards17

9/14/2015BCHB Edwards18 Exercise 2 Write a Python program to determine whether or not a DNA sequence consists of a (integer) number of (perfect) "tandem" repeats. Test it on sequences: AAAAAAAAAAAAAAAA CACACACACACACAC ATTCGATTCGATTCG GTAGTAGTAGTAGTA TCAGTCACTCACTCAG Hint: Is the sequence the same as many repetitions of its first character? Hint: Is the first half of the sequence the same as the second half of the sequence?