Www.ias2015.org Assay To Measure The Latent Reservoir Of Replication-Competent HIV-1 In Suppressed Patients Based On Ultra Deep Sequencing Sook-Kyung Lee.

Slides:

Advertisements

Similar presentations

Purging the HIV-1 Reservoir Through the Disruption of the PD-1 Pathway

Advertisements

Measuring the latent HIV Reservoir

Reference mapping and variant detection Peter Tsai Bioinformatics Institute, University of Auckland.

Supplementary Figure S1 Distribution of observed (blue) and Poisson expected (red) standard deviation of human-chimpanzee divergence over different window.

Interactive Workshop “HIV Cure 101”: Challenges in identifying and targeting the HIV reservoir Sarah Palmer Centre for Virus Research Westmead Millennium.

Controversies in HIV Cure Research Debate 1. Is there ongoing replication under HAART? Mario Stevenson and Frank Maldarelli Moderator: Steve Deeks.

1 HIV Curative Strategies: Key Research Priorities Deeks S, et al., (2013) Nat Rev Immunol. 12(8):

In vivo analysis of HIV replication and persistence in the myeloid compartment J. Honeycutt, A. Wahl, J. Foster, R.A. Spagnulo and J. Victor Garcia Division.

Statistics 101 Class 9. Overview Last class Last class Our FAVORATE 3 distributions Our FAVORATE 3 distributions The one sample Z-test The one sample.

2014 “Towards an HIV Cure” symposium Melbourne A novel assay that precisely measures the size of the latent HIV reservoir reveals that ART-nai ̈ ve individuals.

Measuring the latent HIV Reservoir

CELL CULTURE AND DIAGNOSTIC VIROLOGY. Since the discovery by Enders (1949) that polioviruses could be cultured tissue, cell culture has become a very.

David M. Margolis, MD Professor of Medicine Towards an HIV cure: medical, social and ethical challenges in research and testing.

Enzyme-Linked Immunosorbent Assay (ELISA) Mary Lea Killian USDA APHIS VS National Veterinary Services Laboratories Ames, Iowa.

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Replication capacities of chimeric NL4-3 encoding gag-protease from recent HIV-1 isolates are significantly reduced compared to those derived from isolates.

2014 “Towards an HIV Cure” symposium Melbourne

Immune correlates of unusual control of viral replication after cessation of HAART Ellen Van Gulck 1, Leo Heyndrickx 1, Céline Merlin 1, Sandra Coppens.

Rémi Cheynier Victor Appay Anne Hosmalin Gianfranco Pancino Vincent Vieillard Brigitte Autran Françoise Brun-Vezinet Charlotte Charpentier Diane Descamps.

Persistent low-level viremia despite clinically successful antiretroviral therapy appears correlated with more frequent resting CD4+ T cell Infection NM.

HIV Cellular Pathogenesis III

Stability of HCV, HIV-1 and HBV nucleic acids in plasma samples stored at different temperatures Marta José, Rodrigo Gajardo and Juan I. Jorquera Instituto.

Characterization of persistent HIV-1 in a broad spectrum of CD4 + T-cells isolated from peripheral blood, bone marrow, lymphoid tissue and gut associated.

A murine viral outgrowth assay to detect residual HIV-1 in patients with undetectable viral loads Kelly A. Metcalf Pate, DVM, PhD, DACLAM Joel N. Blankson,

Detecting Infectious HIV in Human Milk Miles W. Cloyd, Ph.D. Professor Department of Microbiology & Immunology University of Texas Medical Branch Galveston,

1 Resistance and Tropism - Maraviroc Lisa K. Naeger, Ph.D. Division of Antiviral Products Food and Drug Administration April 24, 2007 FDA Antiviral Advisory.

Anti-HIV Antibody Responses Reflect the Quantifiable HIV Reservoir Size Sulggi Lee, M.D., Ph.D. Assistant Professor of Medicine University of California,

Measuring the HIV reservoirs: new and improved methods Sarah Palmer Westmead Millennium Institute for Medical Research University of Sydney.

Effect of 24 Week Intensification with a CCR5-Antagonist on the Decay of the HIV-1 Latent Reservoir IAS HIV RESERVOIRS WORKSHOP, 16 & 17 JULY 2010, VIENNA.

Phylodynamically Estimated HIV Diversification Rates Reveal Prevention of HIV-1 by Antiretroviral Therapy Jeffrey B. Joy, Richard H. Liang, Rosemary M.

Persistent HIV-1 infection in duodenal mucosa and memory CD8+ T cell differentiation Liliana Belmonte 1 PhD; Alberto Zalar 2 MD; Patricia Baré 1 PhD; Noel.

HIV Cellular Pathogenesis III Benhur Lee, M.D.. Adult v. infant (IgG v. IgA) CTL response (MHC tetramers) p24 antigenimia Ab response Viral load.

Learning About an HIV Cure by Doing Studies in HIV+ Subjects Alan Landay, PhD Professor and Chairman Department of Immunology/Microbiology Rush University.

HIV rebound and meningoencephalitis following ART interruption after allogeneic hematopoietic stem cell transplant: an investigation of the source of HIV.

Next Generation Deep Sequencing to Evaluate Viral Tropism in HIV-1 Patients Exposed to Maraviroc Add-On Therapy for 8 Days *Rachel A. McGovern, Art F.Y.

Figure 18.1 Comparing the size of a virus, a bacterium, and a eukaryotic cell.

Robert F. Siliciano, MD, PhD Professor of Medicine The Johns Hopkins University School of Medicine Baltimore, Maryland Update on HIV Cure Research FORMATTED:

 Routine viral diagnostics: indirect and direct detection of viruses. ◦ Indirect detection: serological tests; ◦ Direct detection:  Viral antigens;

TIGER * Biosensor for Emerging Infectious Disease Surveillance *Triangulation Identification for Genetic Evaluation of Risks Ranga Sampath David Ecker.

Methods in Virology.

Date of download: 6/27/2016 Copyright © 2016 American Medical Association. All rights reserved. From: HIV-1 Drug Resistance Profiles in Children and Adults.

Adefovir Suppresses HBV DNA Levels in Lamivudine-Resistant HIV/HBV Patients Slideset on: Benhamou Y, Thibault V, Vig P, et al. Safety and efficacy of adefovir.

Setting Up Copy Number Variation Assays

Sara Williford, M. D. , Shuntai Zhou, M. D. , Christina Burch, Ph. D

Rapporteur Report – Track A Basic and Translational Sciences

HIV Cure: Current Status and Future Perspectives

Supplemental Digital Content 1. Table: Primers

Volume 65, Issue 1, Pages S2-S21 (October 2016)

Christine M. Fennessey, Ph.D AIDS and Cancer Virus Program

Volume 2, Issue 8, Pages (August 2015)

by JoAnn Castelli, Elaine K

Quantitative analysis of the latent reservoir during treatment interruption. Quantitative analysis of the latent reservoir during treatment interruption.

Comparisons of the circulating latent reservoir and rebound viruses.

Volume 5, Issue 6, Pages (June 2002)

In vitro and in vivo replication of MKWV and interferon-antagonism activity of MKWV NSs. (a) MKWV isolate MKW73 was used to inoculate cells derived from.

Li Huang Duke University, North Carolina, USA

Prevention of Genital Herpes Simplex Virus Type 1 and 2 Disease in Mice Immunized with a gD-Expressing Dominant-Negative Recombinant HSV-1 Richard Brans,

Molecular Characterization, Reactivation, and Depletion of Latent HIV

Volume 24, Issue 8, Pages (August 2018)

Volume 18, Issue 4, Pages (October 2015)

Process Control: Introduction to Quality Control

Next-generation sequencing technology in clinical virology

Volume 18, Issue 5, Pages (January 2017)

Volume 47, Issue 4, Pages e3 (October 2017)

Viral reservoirs, residual viremia, and the potential of highly active antiretroviral therapy to eradicate HIV infection Lin Shen, MD, Robert F. Siliciano,

Introduction. Activation of HIV-Specific CD8+ T Cells from HIV+ Donors by Vesatolimod.

C. difficile induces tnaA overexpression in enterotoxigenic E. coli.

Harry I Segall, Eunsun Yoo, Richard E Sutton Molecular Therapy

Alteration calling accuracy and concordance with reference platforms.

Volume 18, Issue 5, Pages (January 2017)

Presentation transcript:

Assay To Measure The Latent Reservoir Of Replication-Competent HIV-1 In Suppressed Patients Based On Ultra Deep Sequencing Sook-Kyung Lee Shuntai Zhou Nancie Archin David Margolis Ronald Swanstrom University of North Carolina

New Assay Viral Outgrowth Assay (VOA) Detects replication competent virus: determines titer by end-point dilution Quantitative-Viral Outgrowth Assay: Current Gold Standard To Measure Latent Reservoir Of HIV-1

5 wells each containing 2 million resting T cells and one negative control well: more cells, cultures can detect more measured events = greater accuracy Ultra deep sequencing analysis of culture supernatant of individual wells Culture for 7-14 days Count distinct viral lineages in each well Primer ID-Based Deep Sequencing Q-VOA 6-well plate: 5 cultures of 2 million resting T cells each

1 Primer ID-based deep sequencing to quantitate virus number without limiting-dilution IUPM Calculation – Correct For Unseen Duplicates In the Same Well 1.Generate a phylogenetic tree using all distinct viral lineages observed from a patient in all wells tested 2.Count the number of wells containing the same viral lineage 3.Determine the titer of all individual viral lineages based on Poisson distribution 4.Add all the titers from the individual viral lineages Measuring the number of lineages per well, i.e. the number of different sequence variants 4 3 2

Hypothesis: Viral Outgrowth Lineages Induced From Different Cells Are Often Distinct In Chronic Patients Viral Outgrowth Assay (VOA) Viruses scored as p24 positive for the presence of HIV-1 from viral outgrowth assay Ultra deep sequencing analysis Phylogenetic tree to compare viral lineages derived from different wells Distinct viral sequences are often observed when cells are derived from chronic patients. Correct for duplicates with the Poisson distribution.

IUPM-Ultra Deep Sequencing (UDS) Compared to IUPM-VOA r=0.882 P< IUPM-VOA IUPM-UDS A strong correlation was observed between IUPM-VOA and IUPM-UDS

o For all assays, accuracy is determined by number of events observed. o IUPM-UDS titers are strongly correlated with IUPM- VOA and allows the inclusion of all individual outgrowth events in determining the titer of the latent reservoir o IUPM can be under-estimated when the same viral sequences is induced from different cells in the same well. This problem is corrected by Poisson distribution. o IUPM can be over-estimated (i.e. artifactual lineages) due to recombinants produced during culture and PCR, and due to errors during cDNA synthesis and PCR. Inclusion of an abundance cut-off will remove most of this error but could lose some slow-growing viruses. Summary