Blood, Blood spatter and DNA Ch. 7 and 8. Forensic blood video Blood spatter video Dexter-Dexter- 2 3 4 5 6 *23456 Science of Murder- bloodScience of.

Slides:



Advertisements
Similar presentations
Blood and Blood Spatter. Blood 3 Types of Cells – Red Blood Cells – White Blood Cells – Platelets All contained in plasma that contains proteins: – Antibodies.
Advertisements

The Nature of Blood. Serology Serology is the examination and analysis of body fluids. A forensic serologist may analyze a variety of body fluids including.
Ch 8: Blood & Blood Spatter: Day 1 Vocabulary – p195
The Structure and Function of Blood. Composition of Blood Blood is responsible for….. – Transporting gases (oxygen & carbon dioxide) – Transporting waste.
Blood Typing Practice More Blood Notes Forensic Science 12/19/14.
Identification and Characterization of Blood and Bloodstains.
Blood Spatter.
9 th Grade Forensic Science Courtesy T. Trimpe 2006.
Blood, Animal Cells & DNA Noadswood Science, 2012.
1 BLOOD 2 Introduction and History Blood typing can provide class evidence Using DNA from blood is individual evidence Blood spatter patterns provide.
Bloodspatter Pattern Analysis
explain the composition of blood describe the function of blood cells
Chapter 8 Blood and Blood Spatter …let’s complete a couple more case studies before we discuss blood! By the end of this unit you will be able.
Forensic Science. Your identity shows up in more than your driver’s license. Blood, sweat, and tears are just a few of the bodily fluids that investigators.
Blood and Blood Spatter Serology Blood Spatter Analysis.
Forensic Science T. Trimpe 2006
Chapter 12 Forensic Serology. Forensic Serology Introduction 1901, Karl Landsteiner found blood to be distinguishable by group –Led to the classification.
Forensic Science T. Trimpe 2006
Blood & Blood Evidence Forensic Science 2.
BLOOD BASICS Forensic Science & Blood Typing T. Trimpe 2006
Explain the composition of blood Describe the function of blood cells
Forensic Serology. Blood l l A complex mixture of cells, enzymes, proteins & inorganic substances l l Fluid portion of blood is called the plasma (55%
Forensic Science T. Trimpe 2006
Forensic Science T. Trimpe 2006
Blood Types.
Forensic Science. Parts of blood Red blood cells Carry Oxygen Contain the antigens Most abundant cells in body White blood cells Part of the immune system.
Chapter 12 Forensic Serology
Forensic Science: Fundamentals & Investigations, Chapter 8 1 Chapter 8 Blood and Blood Splatter By the end of this chapter you will be able to: explain.
Intro to Blood & Forensic Serology Forensic Science 12/15/14.
BLOOD AND BLOOD SPLATTER Chapter 8. Composition of Blood Blood is a tissue that circulates around through the body. There are 3 types of cells in blood:
Forensic Serology Identification Using Blood Groups.
Forensic Science: Fundamentals & Investigations, Chapter 8 1 Chapter 8 Blood and Blood Spatter By the end of this chapter you will be able to: o Explain.
Forensic Science: Fundamentals & Investigations, 2e Chapter 8 1 All rights Reserved Cengage/NGL/South-Western © 2016.
Forensic Science: Fundamentals & Investigations, Chapter 8 1 Chapter 8 Blood and Blood Splatter By the end of this chapter you will be able to: explain.
Forensic Science: Fundamentals & Investigations, Chapter 8 1 Chapter 8 Blood and Blood Splatter By the end of this chapter you will be able to: o Explain.
CHAPTER 8.1: BLOOD AND BLOOD SPATTER * Change Your Life.
Forensic Serology: Blood and Blood Spatter Evidence.
Chapters 11 and 12 Exam Review
Blood & Blood Spatter.
Blood Evidence Chapter 10.
explain the composition of blood describe the function of blood cells
Explain the composition of blood Describe the function of blood cells
Forensic Serology Forensic Science.
Blood and Blood Splatter By the end of this unit you will be able to:
Blood Spatter.
Explain the composition of blood Describe the function of blood cells
Composition and Function
Blood Spatter
Blood can provide various evidence to investigators at a crime scene.
FORENSICS OF BLOOD SUNDAY ACADEMY
Composition and Function
Blood & Blood Spatter Catalyst - Tuesday,
Explain the composition of blood Describe the function of blood cells
Explain the composition of blood Describe the function of blood cells
Blood Splatter 1939—splatter patterns first analyzed
Blood and Blood Spatter
Composition and Function
Blood Basics Forensic Science T. Trimpe
Explain the composition of blood Describe the function of blood cells
Chapter 8 Blood and Blood Splatter Introduction and History
Explain the composition of blood Describe the function of blood cells
Blood and Blood Spatter
explain the composition of blood describe the function of blood cells
Explain the composition of blood Describe the function of blood cells
Forensic Serology: Blood and Blood Spatter Evidence
Explain the composition of blood Describe the function of blood cells
Presentation transcript:

Blood, Blood spatter and DNA Ch. 7 and 8

Forensic blood video Blood spatter video Dexter-Dexter *23456 Science of Murder- bloodScience of Murder- blood *

Blood typing If blood is found at the scene of a crime, it can be tested for blood type. This may narrow down suspects – Cheaper, easier, and faster than DNA testing, which provides individual evidence

Blood spatter A spatter pattern can give information about the truthfulness of an account by a witness or a suspect It also can provide information about the origin of the blood, the angle and velocity of impact and type of weapon used

Composition of Blood Whole blood has cells and plasma (fluid with hormones, clotting factors and nutrients) Red blood cells carry oxygen to the body’s cells and CO2 away White blood cells fight disease and foreign invaders Platelets aid in blood clotting

What is blood typing? Antibodies are proteins secreted by white blood cells that attach to antigens to destroy them (defense machanism) Antigens are foreign molecules that react to antibodies (causes agglutination or clumping) In this case, antigens are carbohydrate tags on red blood cells that are read by your immune system If your immune system recognizes them, everything is fine If your immune system sees them as foreign, it attacks!

A person with type A blood has A antigens on the surface of their red blood cells. A-type individuals do not make antibodies against A antigens. A-type individuals make antibodies against B antigens

If a person with Type A blood receives a Type B transfusion, the anti-B antibodies will bind the B antigens Donor cells are destroyed by complement- mediated lysis Can lead to jaundice and kidney damage Death Therefore, they can only receive A or O blood

A person with type B blood has B antigens on the surface of their red blood cells. B-type individuals do not make antibodies against B antigens. B-type individuals make antibodies against A antigens Can only receive B or O blood

A person with type AB blood has A and B antigens on the surface of their red blood cells. AB-type individuals do not make antibodies against A or B antigens. Can receive A, B, AB, or O blood – Called the universal recipient

A person with type O blood has no antigens on the surface of their red blood cells. O-type make antibodies against A and B antigens Can only receive other O blood, but can donate to all other blood types – Known as the universal donor

Type Percent A39 B12 AB4 O45

What is Rh factor? Rh Factor is another antigen present on RBCs – it’s where the +/- of your blood type comes from – named after the Rhesus Monkey (where they were first discovered) Can cause problems with transfusions – Rh negative people can’t receive positive blood (get an antigenic reaction- destruction of cells) Also get similar reaction when Rh-negative mother is carrying an Rh-positive fetus Also get similar reaction when Rh-negative mother is carrying an Rh-positive fetus

If the sample clots, then the antibodies are binding, so the antigen must be present – If Anti-A makes it clot, A is present –>A (AB) – If Anti-B makes it clot, B is present –>B (AB) – If both Anti-A and Anti-B samples clot, Both antigens are present –> AB – If neither Anti-A or Anti-B makes it clot, neither antigen is present –> O – If Anti-Rh makes it clot, Rh factor is present -> +

Human Blood Testing Blood Compatibility Is that Blood

Luminol Presumptive test ● The first step in an investigation. ● Seen on most CSI TV shows as the blue glowing light test. ● Presumptive Test: Possibility that it is blood or it is not blood. ● It uses luminol, a peroxide and a base.

Presumption Blood Testing (using the kastel-meyer video) (using the kastel-meyer video) Kastel-Meyer Blood Test It will not prove that a sample is definitely blood, it simply supports the idea that the sample could be blood Kastel-meyer is used because of ease of use, doesn’t destroy DNA and is very sensitive (can detect 1 drop in 10,000 drops), positive test results in easily seen color change due to presence of hemoglobin Uses alcohol, phenophthalein (special prep- not the kind used in acid/base testing) hydrogen peroxide. It undergoes a oxidation-reduction reaction Look for no color change with the addition of alcohol and phenophtalein and blue color with hydrogen peroxide

Blood Spatter (dexter explain) (blood spatter interpretation)dexter explain (blood spatter interpretation)

Splatter is the sound a liquid makes when it comes in contact with an object Spatter is the pattern blood makes on an object

Blood spatter The pattern can help to reconstruct the events surrounding a shooting, stabbing or beating Can determine: Direction blood traveled Angle of impact Point of origin of the blood Velocity of the blood Manner of death

Common Bloodstain Patterns Walking Drip Pattern Wipes Swipes Transfer Stains Arterial Spurts (vertical & horizontal) Cast-off Spatter

When blood falls from a height or at a high velocity, it can overcome its natural cohesiveness and form satellite droplets When it falls onto a less-than-smooth surface, it can form spiking patterns around the drops

Directionality The shape of an individual drop of blood provides clues to the direction from where it originated

Shapes Gun Hammer 8/fsb05.pdf

Low Velocity - This type of spatter is usually caused by an impact to the blood source at a rate of 5 feet per second and is usually about 4 millimeters in diameter. (victim walking) Medium Velocity - This type of spatter is usually caused by an impact to the blood source at a rate of feet per second. Stains caused by this type of force are usually 1-3 millimeters in diameter, but may be larger or smaller. (bat- stab) High Velocity - This type of spatter is usually caused by an impact to the blood source in excess of 100 feet per second and is usually less than 1 millimeter in diameter, although it can be larger or smaller. (gun)

Angle of Impact

Creating Reference Bloodstain Patterns

Blood spatter video Dexter-Dexter Science of Murder- blood

DNA Fingerprinting A more modern and popular approach, DNA fingerprinting can be very conclusive Alec Jefferys DNA evidence

DNA can be isolated from many sources: Blood Semen Saliva Hair Skin cells Bone Teeth Tissue Urine Feces Vomit Condoms Hat bands Bras Cigarette Butts Chewing gum Envelopes Drinking Cups Under victim’s fingernails

Running DNA Video Death, drugs, driving and DNA: Forensic Potpourri (you tube or Research Channel)you tubeResearch Channel

PCR (Polymerase Chain Reaction) is used to make a small amount of DNA (like you’d find at the SOC) into a large amount for testing Restriction enzymes are used to cut the DNA into fragments at specific sites Gel Electrophoresis is used to separate the fragments into a pattern called a fingerprint These fingerprints can be matched to fingerprints from DNA isolated from suspects (usually by mouth swab)

DNA STRAND: CTGGCTAGGCTACCATGCCCGTAAAT Everyone has unique DNA except twins

Restriction Enzyme We will use TA-ase, an imaginary enyzme, to cut our DNA Sample DNA strand CTGGCTAGGCTACCATGCCCGTAAAT

Electrophoresis Separates fragments by size Largest fragment travels least

Gel electrophoresis separates the resulting f ragments by size – the largest fragment moves the slowest through the gel so it stays up at the top

And we get a fingerprint that looks something like this:

Fingerprints can then be compared to decide which DNA is which

OJ crimes of the century (DNA)

roblem_sets/DNA_forensics_2/DNA_forensi cs.html roblem_sets/DNA_forensics_2/DNA_forensi cs.html A_fingerprint.php A_fingerprint.php