Objectives Know radiation and mutagenic chemicals increase the mutation rate and can cause genetic diseases and cancer. Application: Consequences of radiation.

Slides:

Advertisements

Similar presentations

Chapter 13.3 (Pgs ): Mutations

Advertisements

Gene Mutations. Target #17- I can describe a gene mutation Gene mutation: a permanent heritable change in the sequence of bases in DNA – Effect can cause.

What is a mutation? Mutations are changes made to an organism’s genetic material. These changes may be due to errors in replication, errors during transcription,

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

How is the amino acid sequence determined?

14.4 Gene Mutations. What is a Mutation? A mutation is any change in the amount or structure of the DNA of an organism. KEY POINT: If this occurs in somatic.

Connect! Why sometimes do we see albino animals? What causes albinism?

Genetic Mutations.

Mutations (12.4) State Standard

Chapter 11.3 Genetic Changes.

Section 11.3 MUTATIONS Section 11.3 pgs

Lecture 10 – DNA Mutation Based on Chapter 07 Copyright © 2010 Pearson Education Inc.

Mutations 3.29 Recall that mutation is a rare, random change in genetic material that can be inherited. 3.31 Understand that many mutations are harmful.

Mutations Chapter 12.4.

DNA, Mutations and Hazardous Waste. Prokaryote Cell.

Mutations 13.3.

Cell Biology: Protein Synthesis Lesson 2 – Mutations( Inquiry into Life pg )

Variation. Types of variation Variation means differences between species (remember dichotomous key) or differences within a species Types of variation:

What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...

Year 10, Pathway C  Define the term mutation  Describe useful and harmful examples of mutations  Describe how mutations occur.

Holy Family Catholic High School 17th April 2007 Developing medicines + Immunity UNIT 11.4 Controlling infectious disease Form 10 A4.

MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.

DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

APHY398C 2/23/ Effects of Radiation. APHY398C 2/23/ Effects of Radiation   Cells of mammals 70-85% water, 10-20% proteins, 10% carbohydrates.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology.

Mutations Mutations are changes in DNA Mutations are changes in DNA These can occur in: These can occur in: Somatic cells – can cause tumours/cancersSomatic.

13.3 Mutations. POINT > Define a gene in simple terms POINT > Define and describe genetic mutations POINT > Distinguish between gene and chromosomal mutations.

MS-LS 3-1. I will explain how mutations can effect organisms in positive, negative, and neutral ways.

Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.

Higher Biology Mutations part 3.

21.7 Genetic Mutations A peacock with albinism does not produce the melanin needed to make bright colors for its feathers. Learning Goal Identify the.

Genetics Lesson 4 Mutations.

IB syllabus 3.4.U2 Gametes are haploid so contain only one allele of each gene. 3.4.U3 The two alleles of each gene separate into different haploid daughter.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Big Q: What are mutations? Big Q: How do mutations affect genes?

Mutations (12.4) State Standard

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Mutations -Mutations are permanent changes in the sequence of DNA

The inheritance of genes follow patterns

Mutations 12-4.

DNA Mutations and Repair

Molecular Phylogenetics

More Inheritance 3.4 continued.

Ch.6s.2 Genetics: Protein Synthesis

Mutations And Genetic Disorders

Recombinant DNA & Mutations

10th Grade Biology Mr. Walker

Mutations Chapter 8.7

3.4 Inheritance Nature of science:

Objective: Explain the main types of mutations

Genes & Mutations Miss Richardson SBI4U.

Mutations The fat cat sad.

Section 20.4 Mutations and Genetic Variation

Modern Evolutionary Theory

3.4 Inheritance Nature of science:

Changes in DNA TEK 6E: identify and illustrate changes in DNA and evaluate the significance of these changes.

Mutations Big Q: What are mutations?

DNA Mutations Types & their effects.

Presentation transcript:

Objectives Know radiation and mutagenic chemicals increase the mutation rate and can cause genetic diseases and cancer. Application: Consequences of radiation after nuclear bombing of Hiroshima and the Chernobyl. Outcomes 3: Describe causes and consequences of mutation. 5: Explain the effects of large doses of radiation such as in Hiroshima and Chernobyl. 7: Evaluate the short and long term consequences of misuse of nuclear radiation. Key terms: radiation, mutagenic, cancer, genetic disease.

A mutagenic substance or mutagen is a physical or chemical agent with the potential to change DNA. Examples include: Radiation Various chemicals Viruses Bacteria Outcomes 3: Describe causes and consequences of mutation. 5: Explain the effects of large doses of radiation such as in Hiroshima and Chernobyl. 7: Evaluate the short and long term consequences of misuse of nuclear radiation. Key terms: radiation, mutagenic, cancer, genetic disease.

What are the results of mutation?Outcomes 3: Describe causes and consequences of mutation. 5: Explain the effects of large doses of radiation such as in Hiroshima and Chernobyl. 7: Evaluate the short and long term consequences of misuse of nuclear radiation. Key terms: radiation, mutagenic, cancer, genetic disease. Cancers Genetic disease New characteristics Eventual evolution? Nothing!

What are the results of mutation?Outcomes 3: Describe causes and consequences of mutation. 5: Explain the effects of large doses of radiation such as in Hiroshima and Chernobyl. 7: Evaluate the short and long term consequences of misuse of nuclear radiation. Key terms: radiation, mutagenic, cancer, genetic disease. Cancers Genetic disease New characteristics Eventual evolution? Nothing!

In genetics, the mutation rate is a measure of the rate at which various types of mutations occur over time. Mutation rates are typically given for a specific class of mutation, for instance point mutations, small or large scale insertions or deletions. Outcomes 3: Describe causes and consequences of mutation. 5: Explain the effects of large doses of radiation such as in Hiroshima and Chernobyl. 7: Evaluate the short and long term consequences of misuse of nuclear radiation. Key terms: radiation, mutagenic, cancer, genetic disease.

Case studies Hiroshima Chernobyl For each: What When Where Why Short term consequences Long term consequences Outcomes 3: Describe causes and consequences of mutation. 5: Explain the effects of large doses of radiation such as in Hiroshima and Chernobyl. 7: Evaluate the short and long term consequences of misuse of nuclear radiation. Key terms: radiation, mutagenic, cancer, genetic disease.