Genetic Mutations Unit 2-2 Notes Mr. Hefti – Pulaski Biology.

Slides:



Advertisements
Similar presentations
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring, only to descendant cells)
Advertisements

Genetic Changes Any mistake or change in the DNA sequence is called a mutation. Types of mutations are: point mutation frameshift mutation chromosomal.
6.2 Human Genetic Disorders
Chapter 14 Sec 1: Genes in Action
 What’s a “mutagen”?  What does a mutation do to DNA?  If a mutation affects a gene, then what might happen to the protein sequence?
14.4 Gene Mutations. What is a Mutation? A mutation is any change in the amount or structure of the DNA of an organism. KEY POINT: If this occurs in somatic.
Understanding heredity
CHAPTER 14: Genes in Action
Review for Genetics Test
DNA Mutations & Disorders
Genetic Disorders.
Mutations are changes in DNA that may or may not affect phenotype.
1. Silent Mutations  Change in nucleotide has no effect on amino acid in protein  Occurs:  Introns  Wobble effect.
Mutations. What is a mutation? Mutation – A change in the DNA that affects inherited genetic information They may be gene mutations which result from.
Types of Mutations The power of the BASE!!. A MUTATION is a change in the DNA 1) Chromosomal Mutations – affect MANY genes ex. Down syndrome 2) ***Gene.
HUMAN GENOME VOCAB ONLY. What disorder is it? Mutation in the blood clotting protein makes person unable to stop bleeding after an injury _______________.
Mistakes Happen DNA is the genetic material of living organisms and is located in the chromosomes of each cell. What happens if a mistake is made when.
MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.
MUTATIONS.
Because Stuff Happens Mutations.
Mutations
Mutations Learning Targets: Describe different gene mutations.
Genetic Disorders Diseases. What is a Genetic Disorder or Disease? A genetic disorder is an abnormal condition that a person inherits through genes or.
Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,
What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...
BIOLOGY HONORS MUTATIONS. WHAT IS A MUTATION? A change in DNA Can cause changes in organism Happen randomly Can be beneficial, neutral, or harmful For.
Human Genetic Disorders Notes. What causes genetic disorders? Mutations, or changes in a person’s DNA.
Mutations Changes in DNA may result in disease. Mutations: Page 96 1) Define mutation from page 224 in your textbook. 2) Decide from paragraph 2 if all.
Welcome to Genetic Mutations! 7x2WSY 7x2WSY.
Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.
CH Mutations in Genes Objectives: 1.Describe the following types of mutations: a.Base substitution b.Base insertion or deletion 2. Explain what can.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.
GENETICS AND GENETICALLY LINKED DISEASES Chapter 22.
MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.
1.Most genetic disorders result from a mutation in one gene. a.Mutation: a change in an organism’s genetic material (DNA) 2.A mutated gene produces a.
GENETIC MUTATIONS What is this picture depicting?.
Because Stuff Happens. A. Mutation Overview  Any change or random error in the nucleotide sequence (either DNA or mRNA) is called a mutation  Can occur.
MUTATIONS 1B LIVING ENVIRONMENT MURTAUGH. ESSENTIAL QUESTIONS What is a mutation? How is gene mutation and a chromosome mutation different? Do all mutations.
Genetic Disorders Cystic Fibrosis
AIM: What causes genetic disorders. Do Now: What are genetic disorders
Because Stuff Happens. A. Mutation Overview  Any change or random error in the nucleotide sequence (either DNA or mRNA) is called a mutation  Can occur.
Human Genetic Mutations
Do Now: What is a gene? A sequence of nucleotides
Mutations.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
Mutations.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
Copyright Pearson Prentice Hall
Mutations (Ch 13.3).
MUTATIONS.
Mutations 5.4.
Mutations.
Mutations.
Chapter 11.6 When it all goes Wrong
Mutations Section 12-4.
DNA Mutations.
MUTATIONS.
Mutations.
Human Genetic Disorders
Welcome to Genetic Mutations!
Mutations Ms MacCormack Fall 2018.
MUTATIONS.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
MUTATIONS.
Lesson 35 Mutations.
DNA, RNA, and Proteins.
Presentation transcript:

Genetic Mutations Unit 2-2 Notes Mr. Hefti – Pulaski Biology

1. Genetic Mutations “a change in the DNA of a gene” –Mutations in gametes can be passed on to offspring –Mutations in body cells affect only the individual in which they occur

2. Categories Point Mutations –Change in one or just a few bases in a gene Frameshift Mutations –Cause genes to be read in the wrong three- nucleotide sequence

Three nucleotide sequences are called “codons” See if you can find the amino acid that these DNA sequences code for using the Universal Codon Chart… New rule: when referring to the amino acids that DNA codes for, T still goes with A, but now A goes to U (which stands for Uracil). C A TT T A = valine G U A = asparagine A A U

Read from this side first! Read from the top second. Then read from this side third.

2A. Point Mutations Substitution –O–One nitrogenous base is replaced with a different one – CTAGGA – GAUC A U GAU = ? / CAU = ? / CCU = ? –A–Aspartate / Histidine / Proline

2B. Frameshift Mutations Insertion –O–One or more bases are added to a gene – TAGCCT – A G UCGGA AGU = ? / AUC = ? / CGG = ? –S–Serine / Isoleucine / Arginine

2B. Frameshift Mutations Deletion –O–One or more bases are deleted from a gene – CGATAG – _– __CUAUC GCU = ? / AUC = ? –A–Alanine / Isoleucine CUA = ? / UC = ? –L–Leucine / “Nothing”

3. Sources of Mutations X-rays UV rays Radiation Asbestos Alcohol LSD Marijuana Benzene Formaldehyde

4. Genetic Diseases Some genetic diseases are caused by inherited mutations –Sickle cell anemia –Tay-Sach’s disease –Cystic fibrosis –Hemophilia –Huntington’s disease

Sickle cell anemia Recessive Causes for the abnormal development of rbc’s Sickle shape causes cells to break apart or get jammed in blood vessels

Tay-Sach’s disease Recessive Causes infants’ nervous systems to break down –Death in early childhood

Cystic Fibrosis Recessive Causes for the overproduction of mucus Mucus clogs organs, especially lungs making breathing difficult

Hemophilia Sex-linked recessive Blood clotting disorder

Huntington’s disease Dominant Causes brain to gradually deteriorate Usually goes unnoticed until adulthood