Winston Retreat June 2006 S. cerevisiae 2.0
Engineered Biological Systems Nature has optimized biology (“artifacts”) Technologies exist to optimize differently Try to re-engineer so human use-ableso human read-able
Engineered Biological Systems Nature has optimized biology (“artifacts”) Technologies exist to optimize differently Try to re-engineer Of interest to biologists (test models) chemists (atomic control of living systems) technologists (biomaterials, energy, medicine) re-writers so human use-able so human read-able
Bacteriophage T7 39,937 base pairs 57 putative RBSs encoding 60 proteins 51 regulatory elements From D. Endy
Previous Page Sequence (BNL) Dunn & Studier, J. Mol. Bio. 166:477 (1983) From D. Endy
Wild-Type T7 Genes > acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa < From D. Endy
Wild-Type T7 Genes > acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa < T7.1 Parts 28 & 29 acgcaaGgggagAcgacaCggcaggttacggcgctaaggatccggccgcaaagggaggcgacatggcaggttacggcgctaaa > <
From S. Kosuri, D. Endy Genome design algorithm T7 39,937 bps 57 putative RBSs encoding 60 proteins 51 regulatory elements T7.1 41,326 bps 73 “parts”
From D. Endy Wild-Type T7 (T7 + ) Refactor [1-12,179] :T7 +
Two yeast rewrites 1. mtDNA re-org 2. SAGA swap 1. = 2. = from Suzanne Berger to NAS 05/15/06
mtDNA re-org mt DNA 85,779 bps 8 verified protein encoding genes 24 tRNA genes 2 rRNA genes ~20 nucleic acid processing factors encoded by introns
mtDNA re-org COX1, ATP8, ATP6, COB, OLI1, VAR1, COX2, COX3, 8 proteins (7 for ox phos, 1 mt ribosome) 11 dubious ORFs
mtDNA re-org 15S rRNA21S rRNA one Crick tRNA intron encodes I-Sce enzyme
mtDNA re-org Design protein ORFs2 rRNAs25 tRNAs reduces genome by ~ 4.7 kb Design 3.0 might also remove introns reduces genome by ~20.5 kb lose ~20 nucleic acid modifiers might regulate with T7 RNAP instead of RPO41 and MTF1
mtDNA re-org Execution 2.0
SAGA swap Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1
SAGA swap essent’l genes? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1
SAGA swap HAT? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1
SAGA swap HAT+TBPreg? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1
SAGA swap txn reg? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1
SAGA swap HAT+neighbor? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1
SAGA swap core subunits? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1
SAGA swap Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 from Wu Mol Cell (2004) 15:199 Sgf73 Sgf29 Sgf11 Ubp8 Sus1
the end “Break something”