GENE MUTATIONS.

Slides:



Advertisements
Similar presentations
Mutations.
Advertisements

IUG, Spring 2014 Dr. Tarek Zaida
Chapter 8 Section 8.7: Mutations.
MUTATIONS Changes in DNA that affect genetic information.
GENE MUTATIONS aka point mutations. DNA sequence ↓ mRNA sequence ↓ Polypeptide Gene mutations which affect only one gene Transcription Translation © 2010.
Mutations.
What is a Mutation?. change in a DNA sequence that affects genetic information. Mutation:
5. Point mutations can affect protein structure and function
Perubahan bahan genetik: Mutasi What is a Mutation? A mutation : a permanent change in the DNA sequence of a gene. Mutations in a gene's DNA sequence can.
Mutations These are errors made in the DNA sequence that are inherited. These may have negative side effects, no side effects or positive side effects.
Mutations. Mutation  Permanent changes or errors in a DNA sequence  Copied during DNA replication  Therefore heritable  OR may occur during transcription.
Mutations Genetic Changes.
Mutations. What is a mutation? b Changes in the DNA sequence that affect genetic information Normal: Thesunwashotbuttheoldmandidnotgethishat. The sun.
Study the diagram below and be prepared to answer the following questions: What processes are represented by the 1, 2 and 3 in the diagram? What processes.
TTGACATACCCGTAAT What would the complementary strand of this DNA molecule read? AACTGTATGGGCATTA.
MUTATIONS. WHAT ARE MUTATIONS? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.
Genetic Mutations Good, bad or neutral?.
Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.
8.7 Mutations TEKS 6E The student is expected to: 6E identify and illustrate changes in DNA and evaluate the significance of these changes.
Human Genetic Mutations. What is a mutation? Mutations are changes made to an organism’s genetic material. These changes may be due to errors in replication,
Introduction A mutation is a change in the normal DNA sequence. They are usually neutral, having no effect on the fitness of the organism. Sometimes,
Mutations Introduction Every normal cell carries a full complement of genetic material A mutation can occur in: –a somatic (body) cell (aren’t passed.
the Genetic Code Shown as mRNA 5′ → 3′ 64 codons Redundant
 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.
MUTATIONS. Mutations  errors/changes in the DNA sequence that are inherited.  May have a negative effect, a positive effect, or no effect.
PROTEIN SYNTHESIS TRANSCRIPTION: DNA  m RNA TRANSLATION: m RNA  Protein.
Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology.
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.
PROTEIN SYNTHESIS TRANSCRIPTION: DNA  m RNA TRANSLATION: m RNA  Protein.
CHAPTER 14 SECTION 1 Mutations. Are mutations good or bad?  Some mutations lead to genetic disorders  Some mutations may cause a beneficial trait 
Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.
Genetic Mutation. Mutation Greatest source of genetic diversity A change in the sequence of nucleotides of a gene. Some changes to the DNA will alter.
Wild-type hemoglobin DNA Mutant hemoglobin DNA LE Wild-type hemoglobin DNA Mutant hemoglobin DNA 3¢ 5¢ 3¢ 5¢ mRNA mRNA 5¢ 3¢ 5¢ 3¢ Normal hemoglobin.
Mutation Notes Chapter 12-4.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
Mutations.
GENE MUTATIONS aka point mutations © 2016 Paul Billiet ODWS.
GENETIC MUTATIONS Section 5.6 Pg. 259.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
GENE MUTATIONS aka point mutations.
MUTATIONS And their effect.
Biology Mutations SNL Biology Copyright Pearson Prentice Hall.
DNA Mutations & Disorders
Gene Mutations.
MUTATIONS.
Mutations.
Mutations. Mutations Mutation A permanent, heritable change in the DNA of an organism. One or several nucleotides can be added, deleted, or replaced.
I can… Agenda Index Card Question HW Review Translation Notes
Translation Now that the mRNA is created, we must translate that information into protein. Transfer RNA (tRNA) will be used in this process. This process.
Methods used to study mutations
Types of point mutations
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
Mutations changes in the DNA sequence that can be inherited
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
Some mutations affect a single gene, while others affect an entire chromosome.
Mutations.
Section 1: Mutation and Genetic Change
MUTATIONS.
MUTATIONS.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Genetic Mutations Karyotype: the number and visual appearance of the chromosomes in the cell nuclei of an organism or species.
MUTATIONS.
DNA: The Blueprints For Life
C-Notes: Mutations Stnd: BI.4.c 10/23/13
Section 20.4 Mutations and Genetic Variation
Mutations: Changes in Genes
Genetic Mutations.
Presentation transcript:

GENE MUTATIONS

Introduction Every normal cell carries a full complement of genetic material A mutation can occur in: a somatic (body) cell a germinal (reproductive) cell – can be transmitted to offspring

Introduction Split this into codons! Thesunwashotbuttheoldmandidnotgethishat. It should look like this... The sun was hot but the old man did not get his hat. What if we added another T at the beginning? T hes unw ash otb utt heo ldm and idn otg eth ish at.

Mutations...not all are bad! mutations are random changes in genetic material rare events most mutations that are detectable are detrimental some mutations provide variation, allowing for adaptation to the environment (can be favorable) some mutations cannot be detected

Types of Mutations

Silent mutation: does not result in a change in the amino acid sequence of the protein, due to the redundancy of the genetic code or a change in the code on the introns. Eg: The A.A. Phe is coded for by UUU and UUC… if U gets swapped for C on the mRNA strand the mutation will have no effect. Phe will still be coded for!

Missense mutation: a mutation that results in the single substitution of one amino acid in the protein. E g. sickle cell anemia. Only affects one base pair on the DNA or one codon of mRNA. Can be called a base pair substitution in this case.

Sickle Cell Anaemia Sickle cell anemia Blood smear (normal) Image Credit: http://explore.ecb.org/ Blood smear (normal) Image Credit: http://lifesci.rutgers.edu/~babiarz/

Nonsense mutation: a mutation that converts a codon for an amino acid into a stop codon (usually lethal to the cell). Also called a chain termination mutation. AAC – Codes for Asn but if changed to UAA it is now a stop codon UGA, UAA and UAG are the stop codons!

Frame shift mutation: occurs when the reading frame is changed. Base pair deletion (one is missing) or base pair insertion (one is added). Changes the remainder of the code.

Point Mutation: The previous examples are point mutations. They involve one base pair! http://www.youtube.com/watch?v=kp0esidDr-c&feature=related

Chromosomal mutation: shape change or missing piece of chromosome; can result in inactivation of the entire gene

Translocation mutation: occurs when groups of base pairs are relocated from one area of the genome to another, usually between two nonhomologous chromosomes. Results in a fusion protein (two unrelated gene sequences being transcribed together)

Inversion: AUG UUU UUG CCU UCC UUG UUU GUA chromosomal segment reverses its orientation. Gene control is affected.

Some examples!!! DNA mRNA Polypeptide Normal gene GGTCTCCTCACGCCA ↓ CCAGAGGAGUGCGGU Codons Pro-Glu-Glu-Cys-Gly Amino acids

Mutations: Additions Addition: TAG CAT GAG becomes TTA GCA TGA G

Mutations: Additions A frame shift mutation Normal gene GGTCTCCTCACGCCA ↓ CCAGAGGAGUGCGGU Codons Pro-Glu-Glu-Cys-Gly Amino acids Addition mutation GGTGCTCCTCACGCCA ↓ CCACGAGGAGUGCGGU Pro-Arg-Gly-Val-Arg © 2010 Paul Billiet ODWS

Mutations: Deletions Deletion: TAG CAT GAG Becomes TGC ATG AG A

Mutations: Deletions A frame shift mutation Normal gene GGTCTCCTCACGCCA ↓ CCAGAGGAGUGCGGU Codons Pro-Glu-Glu-Cys-Gly Amino acids Deletion mutation GGTC/CCTCACGCCA ↓ CCAGGGAGUGCGGU Pro-Gly-Ser-Ala-Val © 2010 Paul Billiet ODWS

Mutations: Substitutions Substitution: TAG CAT GAG Becomes TCG CAT GAG Similar Pro with one different A.A

Mutations: Substitutions Normal gene GGTCTCCTCACGCCA ↓ CCAGAGGAGUGCGGU Codons Pro-Glu-Glu-Cys-Gly Amino acids Substitution mutation GGTCACCTCACGCCA ↓ CCAGUGGAGUGCGGU Pro-Arg-Glu-Cys-Gly Substitutions will only affect a single codon Their effects may not be serious unless they affect an amino acid that is essential for the structure and function of the finished protein molecule (e.g. sickle cell anaemia)

The genetic code is degenerate A mutation to have no effect on the phenotype Changes in the third base of a codon often have no effect. © 2010 Paul Billiet ODWS

No change Normal gene Substitution mutation GGTCTCCTCACGCCA ↓ CCAGAGGAGUGCGGU Codons Pro-Glu-Glu-Cys-Gly Amino acids Substitution mutation GGTCTTCTCACGCCA ↓ CCAGAAGAGUGCGGU Pro-Glu-Glu-Cys-Gly © 2010 Paul Billiet ODWS

Disaster Normal gene Substitution mutation GGTCTCCTCACGCCA ↓ CCAGAGGAGUGCGGU Codons Pro-Glu-Glu-Cys-Gly Amino acids Substitution mutation GGTCTCCTCACTCCA ↓ CCAGAAGAGUGAGGU Pro-Glu-Glu-STOP © 2010 Paul Billiet ODWS

What Causes Mutations? Spontaneous mutations Induced mutation occur under normal conditions. May involve mispairing during replication Induced mutation caused by mutagenic agents – chemical agent or radiation Examples: (X-rays, formaldehyde, toluene, UV…)

Page 263...great summary chart Do Q 1-4, 6 A great site for review! http://learn.genetics.utah.edu