Supplementary Fig. S1 Determination of T-DNA copy number by Southern blot analysis. Fifteen µg genomic DNA of Bintje and mutant nikku were digested with.

Slides:



Advertisements
Similar presentations
Identification of markers linked to Selenium tolerance genes
Advertisements

Lecture ONE: Foundation Course Genetics Tools of Human Molecular Genetics I.
Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.
Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.
AP Biology: Chapter 14 DNA Technologies
-The methods section of the course covers chapters 21 and 22, not chapters 20 and 21 -Paper discussion on Tuesday - assignment due at the start of class.
Genomic walking (1) To start, you need: -the DNA sequence of a small region of the chromosome -An adaptor: a small piece of DNA, nucleotides long.
Title: Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress Journal.
Figure S1. Genomic PCR of in vitro potato plants transformed with StPTB1 prom (top) and StPTB6 prom (bottom) constructs using nptII-specific primers. Thirty.
Remember the limitations? –You must know the sequence of the primer sites to use PCR –How do you go about sequencing regions of a genome about which you.
Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.
Fig. S1 Illustration of the fine-mapping evolution of cmr1 Arabidopsis mutant. F 2 mutant individuals were used for mapping. Molecular markers used in.
Gene expression (signal intensity) Control Osmotic Salt Drought Root Control Gene expression (signal intensity) Treatment.
AP Biology Biotech Tools Review AP Biology Biotech Tools Review  Recombinant DNA / Cloning gene  restriction enzyme, plasmids,
AtPAT10 TIP1 Akr1p1 Akr2p Erf2p Swf1p Pfa5 Pfa3 GODZ HIP14 Pfa4 AtPAT10 TIP1 Akr1p1 Akr2p Erf2p Swf1p Pfa5 Pfa3 GODZ HIP14 Pfa4 AtPAT10 TIP1 Akr1p1 Akr2p.
Chapter 20: DNA Technology and Genomics - Lots of different techniques - Many used in combination with each other - Uses information from every chapter.
A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.
Chapter 20 DNA Technology and Genomics. Biotechnology is the manipulation of organisms or their components to make useful products. Recombinant DNA is.
Biotech. Southern Blotting Through a series of steps, DNA that has been separated by electrophoresis is applied to a membrane of nylon or nitrocellulose.
WT#3#5#7#9#11#14#15#20#25#30 35S::JAZ13 Root length ratio * * * * * * * * * * Figure S2. Overexpression of native (untagged)
C H-NS (nM) 14 nM FIS28 nM FIS56 nM FISno FIS Figure S1. FIS and H-NS can simultaneously interact with cspA promoter.
Volume 5, Issue 2, Pages (March 2012)
Supplemental Fig. S1 A B AtMYBS aa AtMYBS
2470 bp 1891 bp WT bp 2314 bp A B Fig. S1. Verification with PCR amplification of the.
Potassium Transporter KUP7 Is Involved in K+ Acquisition and Translocation in Arabidopsis Root under K+-Limited Conditions  Min Han, Wei Wu, Wei-Hua Wu,
Supplemental Figure 1 A) B) C)
Genetic markers and their detection
Chapter 4 Recombinant DNA Technology
Chapter 20: DNA Technology and Genomics
Volume 6, Issue 4, Pages (October 2000)
Skin-Specific Expression of ank-393, a Novel Ankyrin-3 Splice Variant
S. Nuka, W. Zhou, S. P. Henry, C. M. Gendron, J. B. Schultz, T
Consequences of T‐DNA insertion on SWP expression in swp mutant.
Stimulation of V(D)J recombination by histone acetylation
Volume 5, Issue 2, Pages (March 2012)
Volume 8, Issue 2, Pages (February 2001)
Fatty Acid Synthesis by Elongases in Trypanosomes
Volume 2, Issue 1, Pages (January 2009)
Potassium Transporter KUP7 Is Involved in K+ Acquisition and Translocation in Arabidopsis Root under K+-Limited Conditions  Min Han, Wei Wu, Wei-Hua Wu,
Volume 12, Issue 6, Pages (December 2010)
Peter Ianakiev, Michael W
Volume 3, Issue 2, Pages (August 2002)
Osteopontin Gene is Expressed in the Dermal Papilla of Pelage Follicles in a Hair- Cycle-Dependent Manner  Tian Yang, Pamela J. Jensen, Robert M. Lavker 
High Frequency Retrotransposition in Cultured Mammalian Cells
Chuxia Deng, Anthony Wynshaw-Boris, Fen Zhou, Ann Kuo, Philip Leder 
Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2
Molecular cloning of pms916 salt hypersensitive T-DNA mutant.
Volume 10, Issue 8, Pages (April 2000)
Identification and Sequencing of a Putative Variant of Proopiomelanocortin in Human Epidermis and Epidermal Cells in Culture  Gong Can, Zalfa Abdel-Malek,
Jung-Ok Han, Sharri B Steen, David B Roth  Molecular Cell 
Volume 9, Issue 1, Pages (January 2016)
Interplay between Two Epigenetic Marks
Development of an HIV-Based cDNA expression cloning system
Frpo: A Novel Single-Stranded DNA Promoter for Transcription and for Primer RNA Synthesis of DNA Replication  Hisao Masai, Ken-ichi Arai  Cell  Volume.
Arabidopsis MSBP1 Is Activated by HY5 and HYH and Is Involved in Photomorphogenesis and Brassinosteroid Sensitivity Regulation  Shi Qiu-Ming , Yang Xi.
Targeted disruption of the Nijmegen breakage syndrome gene NBS1 leads to early embryonic lethality in mice  Jie Zhu, Simone Petersen, Lino Tessarollo,
APOE Gene Targeting (A) Schematic representation of the endogenous APOE locus, the gene targeting vector and the targeted APOE locus. The exons of the.
Col max1-1 max3-9 max4-11 Atd14-1 max2-4 ein2-5 ein3-1 eil1-3 0 day
Chapter 20: DNA Technology and Genomics
Volume 5, Issue 6, Pages (November 2012)
Establishment of monoclonal SMN2-GFP reporter line in HEK293.
Development of an HIV-Based cDNA expression cloning system
Fig. 4. Targeted disruption of STK35 transcripts in mouse.
Expression of multiple forms of MEL1 gene products.
Volume 25, Issue 8, Pages (April 2015)
Volume 2, Issue 1, Pages (January 2009)
MicroRNA Binding Sites in Arabidopsis Class III HD-ZIP mRNAs Are Required for Methylation of the Template Chromosome  Ning Bao, Khar-Wai Lye, M.Kathryn.
Volume 7, Issue 7, Pages (July 2014)
Volume 11, Issue 7, Pages (July 2018)
Volume 5, Issue 3, Pages (May 2012)
Presentation transcript:

Supplementary Fig. S1 Determination of T-DNA copy number by Southern blot analysis. Fifteen µg genomic DNA of Bintje and mutant nikku were digested with restriction enzymes (PciI or PsiI) that cut within the T-DNA, and probed with an AlkPhos direct labeled 600 bp probe, and the signal detected with the CDP-Star detection kit

Supplementary Fig. S2 Revertant plant phenotypes appeared during in vitro tuberization experiment. From left to right, plants with increasing degree of phenotype reversion, as denoted by increased rooting and leaf/stem development. Stem sections of 3-5 cm in length were grown in 40 ml liquid propagation medium at 24±1°C, 16 h photoperiod and μmol photons m -2 s -1 light intensity for 4 weeks followed by 30 days of plant culture in microtuberization medium at 18-20°C in the dark. (Scale bar = 1 cm)

Supplementary Fig. S3 Bintje explants cultured with different amounts of abscisic acid (ABA) in the culture medium. Data were recorded after 1 month of growth on MS medium with vitamins or MS medium with vitamins supplemented with different levels of ABA (Scale bar = 1cm)

Supplementary Fig. S4 Growth data for Bintje explants cultured with different amounts of abscisic acid (ABA) in the culture medium. Data were recorded after 1 month of growth on MS medium with vitamins or MS medium with vitamins supplemented with different levels of ABA. The values are means ± SE (sample size, n=12) of n observations per treatment. The asterisks indicate statistical significance of means in the same parameter estimated using Tukey’s HSD test (* = P < , ** = P < , *** = P < )

Supplementary Fig. S5 Bintje explants cultured with different amounts of NaCl in the culture medium. Data were recorded after 1 month of growth on MS medium with vitamins or MS medium with vitamins supplemented with different levels of NaCl (Scale bar = 1cm)

Supplementary Fig. S6 Growth data for Bintje explants cultured with different amounts of NaCl in the culture medium. Data were recorded after 1 month of growth on MS medium with vitamins or MS medium with vitamins supplemented with different levels of NaCl. The values are means ± SE (sample size, n=12). The asterisks indicate statistical significance of means in the same parameter estimated using Tukey’s HSD test (* = P < , ** = P < , *** = P < )

Supplementary Fig. S7 Potato explants cultured with different amounts of indole-3-butyric acid (IBA) in the culture medium. Bintje (upper panel) and nikku (lower panel) plants after 1 month of culture on MS medium with vitamins (a, f) and MS medium with vitamins supplemented with 20 µM (b, g), 50 µM (c, h), 100 µM (d, i) and 200 µM (e, j) IBA. Arrowheads represent callus-like structures. (Scale bar= 1 cm)

Supplementary Fig. S8 GenomeWalker secondary PCR products. Gene specific primers (GSP1) and nested gene specific primers (GSP2) were designed against the mannopine synthase gene sequences and used with arbitrary primer 1 (AP1) and arbitrary primer 2 (AP2) to amplify potato genomic regions flanking the left border of the T-DNA, from different mutant nikku genomic DNA GenomeWalker libraries. Secondary PCR products from GenomeWalker are shown here. Invitrogen 1 Kb Plus DNA mass ladder (M), SspI library (1), ScaI library (2), NaeI library (3), and MscI library (4). Arrows indicate fragments which were cloned and sequenced