Identifying funding and collaboration opportunities to support the Global Names e-Infrastructure Dimitris Koureas & Vince Smith Natural History Museum.

Slides:



Advertisements
Similar presentations
Professor Dave Delpy Chief Executive of Engineering and Physical Sciences Research Council Research Councils UK Impact Champion Competition vs. Collaboration:
Advertisements

Globalnames.org.  Discovery  Ephemeral  Individualistic  Massive redundancy  Optional  Risk taking.
Use it or lose it: Crowdsourcing support and outreach activities in a hybrid sustainability model for e-infrastructures The ViBRANT project case studies.
1 Ideas About the Future of HPC in Europe “The views expressed in this presentation are those of the author and do not necessarily reflect the views of.
GEO SB-01 Oceans and Society: Blue Planet An Integrating Oceans Task of GEO GEO-IX Plenary November 2012 Foz do Iguaçu, Brazil on behalf of the Blue.
09A_MBM41_EurAqua_powerpoint This is the (draft) default presentation of EurAqua. Question 1: Does it meet your demands? What should be changed? Question.
Richard Lane, Natural History Museum, London Scientific Collections International (SciColl) An international coordinating mechanism OECD GSF Krakow Oct.
High-Performance Computing
Co-funded by the European Union under FP7-ICT Co-ordinated by aparsen.eu #APARSEN Welcome to the Conference !! Juan Bicarregui Chair, APA Executive.
Facilitating biodiversity science through
Izolda Bulvinaite, European Commission ,DG MARE, E1
Presentation Overview
First Marine Board Forum – 15 May Oostende Marine Data Challenges: from Observation to Information From observation to data.
EU Wetland conservation policy. Communication on the Wise Use and Conservation of Wetlands (1995) => first European document dedicated exclusively.
Technical Review Group (TRG)Agenda 27/04/06 TRG Remit Membership Operation ICT Strategy ICT Roadmap.
Dimitris Koureas, Vince Smith & Simon Rycroft Natural History Museum London Linking data, services and communities using Virtual Research Environments.
Erica Allis United Nations Environment Programme Eleventh Caribbean Conference on Sustainable Tourism Development May 9 th -13 th St. Michael, Barbados.
E-Infrastructures in WP European Commission – DG CNECT eInfrastructure Presentation for national contact points.
1 European Development Days Brussels October 2012.
Fourth Annual Summit | Feb | Tucson, AZ Scratchpads for community involvement for natural history collections Dr Dimitris Koureas Biodiversity.
GEO Work Plan Symposium 2012 ID-05 Resource Mobilization for Capacity Building (individual, institutional & infrastructure)
Living with Climate Change Systemic investigation of climate change impacts on our society and efficient adaptation / mitigation scenarios to sustain our.
Director, DG RTD, Directorate International Cooperation
Nurturing a community based sustainability model Support and outreach structures in Scratchpads Livermore L. & Koureas D. Biodiversity Informatics Group.
ISBE An infrastructure for European (systems) biology Martijn J. Moné Seqahead meeting “ICT needs and challenges for Big Data in the Life Sciences” Pula,
EGI-Engage EGI-Engage Engaging the EGI Community towards an Open Science Commons Project Overview 9/14/2015 EGI-Engage: a project.
1 INFRA : INFRA : Scientific Information Repository supporting FP7 “The views expressed in this presentation are those of the author.
Research funding challenge to enable key research for climate services? Attract stakeholders (public, private, community) to co-design research question.
Session Chair: Peter Doorn Director, Data Archiving and Networked Services (DANS), The Netherlands.
Dimitris Koureas, PhD Natural History Museum London Linking layers of biodiversity data: Informatics challenges for the long tail research RDA - Long Tail.
Helix Nebula The Science Cloud CERN – 14 May 2014 Bob Jones (CERN) This document produced by Members of the Helix Nebula consortium is licensed under a.
1 Web: Steve Brewer: Web: EGI Science Gateways Initiative.
Enhancing formal and professional training capacity in Biodiversity Informatics: Collaboration and funding opportunities Dimitris Koureas Natural History.
JOINING UP GOVERNMENTS EUROPEAN COMMISSION Establishing a European Union Location Framework.
EU cooperation on HTA – the way forward Andrzej Rys Director European Commission DG Health and Consumers Health Systems and Products HTA 2.0 Europe - Teaming.
The ERA-NET TRANSCAN-2, in continuity with the preceding ERA-NET TRANSCAN, aims at linking translational cancer research funding programmes in 15 Member.
E u r o p e a n C o m m i s s i o nCommunity Research Global Change and Ecosystems EU environmental research : Part B Policy objectives  Lisbon strategy.
The Ocean-Climate Nexus: Key messages from the EMB 5 th Forum Jan Mees Chair, European Marine Board European Academy of Sciences Symposium Climate change.
The implementation programme for the 2008 SNA and supporting statistics UNECE special session on National Accounts for economies in transition Geneva,
ESSnet(s) Big Data I + II Item 8 of the agenda Joint DIME-ITDG Plenary Luxembourg, 24 Feb 2015.
Towards an European Network of Earth Observation Networks (ENEON): Addressing Challenges and Facilitating Collaboration for non-space based Earth Observations.
Helix Nebula The Science Cloud CERN – 13 June 2014 Alberto Di MEGLIO on behalf of Bob Jones (CERN) This document produced by Members of the Helix Nebula.
Chaitan Baru Senior Advisor for Data Science CISE Directorate National Science Foundation NIEHS Webinar October 27, 2015 Image Credit: Exploratorium. Integrating.
GEO Implementation Boards Considerations and Lessons Learned (Document 8) Max Craglia (EC) Co-chair of the Infrastructure Implementation Board (IIB) On.
EU-China: : Demonstrating Smart Cities achievements Dr Shaun Topham EU eForum.
EGI-Engage is co-funded by the Horizon 2020 Framework Programme of the European Union under grant number EGI vision for the EOSC Tiziana.
WP9– Evaluation, roadmap & development plan Rupert Lueck EMBL – 26 June
EU Horizon 2020 Coordination and support action Enhancing ecoSysteM sERvices mApping for poLicy and Decision mAking Project coordinator: Benjamin Burkhard,
European network for Health Technology Assessment | JA | EUnetHTA European network for Health Technology Assessment THL Info.
European Perspective on Distributed Computing Luis C. Busquets Pérez European Commission - DG CONNECT eInfrastructures 17 September 2013.
Facilitating International Collaboration through New Funding Opportunities Maria Uhle Program Director, International Activities GEO Directorate U.S. National.
EUB Brazil: IoT Pilots HORIZON 2020 WP EUB Brazil: IoT Pilots DG CONNECT European Commission.
The LIFE Programme Iñigo Ortiz de Urbina LIFE External Assistance Regional coordinator Technical Assistance to Support the Development of Green.
Orientations towards the Scoping Paper H2020 Transport Programme Committee Brussels, 22 June 2016 SMART, GREEN and INTEGRATED TRANSPORT.
Priorities for International Development of e-Infrastructure and Data Management in Global Change Research Presentation by Robert Gurney, University of.
What is the Belmont Forum?
Future International Cooperation Perspectives of JPIS
H2020, COEs and PRACE.
Steven Newhouse EGI-InSPIRE Project Director, EGI.eu
Virtual Research Environments The story of Scratchpads
Antonella Fresa Technical Coordinator
The Biodiversity and Protected Areas Management (BIOPAMA) Programme
EXPLORING GLOBAL COOPERATION OPPORTUNITIES
Overview of working draft v. 29 January 2018
Major marine & maritime research challenges
Three Uses for a Technology Roadmap
Brian Matthews STFC EOSCpilot Brian Matthews STFC
Commission proposal for a new LIFE Regulation CGBN meeting
7th Environment Action Programme to 2020 Living well, within the limits of our planet Evaluation - COM (2019) May 2019.
Projects Kick-off Sustainable urbanisation in the context of economic transformation and climate change Margit Noll Chair of the Management Board
Presentation transcript:

Identifying funding and collaboration opportunities to support the Global Names e-Infrastructure Dimitris Koureas & Vince Smith Natural History Museum London Jönköping, Sweden October 27-31, 2014

Maintenance Funding application Project starts Project ends Development phase No further funding or gap in funding for development ? The ephemeral lifecycle of a projectFunding Opportunities

“…telephones do not crash; power supplies do not fluctuate; and clocks do not halt (in general). Similarly, a computational tool (…) must be reliable across time, it must be maintained.” 1 1 Ribes D., Finholt T.A Proceedings of the third International Conference on e-Social Science Funding Opportunities

Project Infrastructure Discovery Individualistic Ephemeral Optional Risk taking Implementation Communal / agreed Persistent Essential Robust & reliable Adapted from Patterson D. 2013, Tempe, Arizona Transition from Funding Opportunities

“An infrastructure must be taken as a process instead of a system.” Shift in the way we approach e-infrastructures and information resources Stable/rigid system Dynamic/open process Outsource to and involve the end user community We need to set up the environment that will enable the community contribution Koerten, H. & van den Besselaar P Sustainable Taxonomic Infrastructures: System or Process? Funding Opportunities

Why Global names services are yet not an established and widely used service? Over-ambitious and non-stepwise approach Minimum engagement of stakeholders Failed to convince of the value outside the taxonomic domain The current situation

“The Global Names Architecture was developed to help nomenclaturalists, taxonomists and biodiversity informaticians do their jobs better and faster…” We need to frame our efforts in the context of existing urgent societal challenges & reveal the universal scientific value of effective name services Need for a cross-domain approach This approach is critical for securing long-term support from external partners Name services will not only benefit taxonomists, will primarily benefit non-taxonomic disciplines

New drugs Clinical research Parasites & vectors Epidemiological data Animal experimental data Biodiversity Biogeographical data Ecological traits Invasive species Ecosystem services Provisioning service data Regulating service data Cultural service data Create new knowledge links at large scale Ethnobiology Medicinal properties Technological uses Vernacular name base Omics research Genomics Proteomics Metabolomics Improved productivity

Gomphonema vulgare Brébisson 1838 G. vulgare Breb. Gomphonema vulgare Brébisson 1838 G. vulgare Breb. Vernaculars Surrogates AAAAAGCTCGTAGTTGGATTTGTGATGGAATTTGAATACTTTTAAAGTGTTCTA GAAACTGTCATCCGTGGGTGGAATTTGTTTGGCATTAGGTTGTCAGRCAGAGGA TGCCTATMCTTTACTGTGAAAAAATCAGTGCGTTCAAAGCAGACTTACGTCGAT GAATGTATTAGCATGGAA Heterotypic synonyms IDs e423b2b9-35b ce9-88e770d368e7

Gomphonema vulgare Brébisson 1838 G. vulgare Breb. Gomphonema vulgare Brébisson 1838 G. vulgare Breb. Vernaculars Surrogates AAAAAGCTCGTAGTTGGATTTGTGATGGAATTTGAATACTTTTAAAGTGTTCTA GAAACTGTCATCCGTGGGTGGAATTTGTTTGGCATTAGGTTGTCAGRCAGAGGA TGCCTATMCTTTACTGTGAAAAAATCAGTGCGTTCAAAGCAGACTTACGTCGAT GAATGTATTAGCATGGAA Heterotypic synonyms IDs e423b2b9-35b ce9-88e770d368e7 Didymosphenia geminata (Lyngbye) Schmidt 1899

Research Data Alliance Opportunities for efficient collaboration Status: Recognised & Endorsed Chairs: Yde de Jong, Nicola Nicolson, Vince Smith, Paul Kirk, Dimitris Koureas Biodiversity Data Integration IG One of 33 Interest groups of RDA Core group created to support the creation of a Working Group on Global Name services Identified the opportunity to work closely together with TDWG – Joint Working Group? Currently 53 members: 80% increase in number of members since last RDA plenary (P4) Case statement to be submitted by Feb 2015

European Strategy Forum on Research Infrastructures (ESFRI) In particular the environmental and health and food clusters Clinical research Biodiversity Ecosystem servicesEthnobiology Omics research In fact we need to find communities as stakeholders/beneficiaries across domains Opportunities for efficient collaboration

How would tackle urgent societal challenges? How does it fit in the Big Data technical challenges? Who are the direct and subsequent beneficiaries? Who are the stakeholders and their investment in supporting this? A standing programme to enable collaboration and secure long-term funding Funding Opportunities

A Minimum Viable Product (MVP) approach – adopt a stepwise strategy 1 Develop a stepwise work programme to achieve the long- term vision Demonstrate impact delivered from every step through lacing together with compelling case studies 2 3 Funding Opportunities An approach to develop a strong funding profile

Three routes to choose from: Small or medium sized grants to develop the building blocks of the service US and EU Foundations and Research Council grants k 3 Large grants from regional funding programmes Horizon m 2 Embed as element in different bigger projects k Funding Opportunities

H2020 pillarExcellent Science H2020 topicCall: H2020-EINFRA | Topic: EINFRA e-Infrastructures for Virtual Research Environments (VRE) Due date :00:00 (Brussels local time) Project acronym LinkD Project titleLinking data, services and communities for predictive modelling of the biosphere Indicative requested EC contributionc. € 8 million Duration of project36 months Supporting the development of a MVP through European e-infrastructure projects Funding Opportunities

COST Actions [EU] e.g. BioUnify (submitted but unsuccessful) Research Coordination Networks (RCN) [US] Networking platforms Funding Opportunities National funding sources Research councils & foundations

Maintenance Funding application Project starts Project ends Development phase Hybrid model Anchoring to core funds + Crowdsourcing to beneficiaries

Thank