PEER: Skills for Success University of Tennessee-Knoxville West Nile Virus Ethel Stanley BioQUEST, Beloit College Sam Donovan University of Pittsburgh.

Slides:

Advertisements

Similar presentations

Purpose (You may click to go to the specific section or proceed through the presentation) Briefly review West Nile virus (WNV) ecology and epidemiology.

Advertisements

Presentation to the Executive Committee PAHO/WHO, June 2003 West Nile Virus (WNV) in Latin America and the Caribbean PAHO Communicable Disease Unit.

Where in the World is Flat Stanley? Learning About Location, Location, Location.

Listen and choose monkey bird frog horse fish Listen and choose 6.

Epidemiology of West Nile Virus in Georgia

EU Parliament Office for Science and Technology- AVIESAN Work shop Brussels, 19 June 2012 Arboviral diseases and the threats for Europe Herve Zeller Emerging.

DIAGNOSIS OF WEST NILE VIRUS INFECTION IN ANIMALS Jon S. Patterson, DVM, PhD, DACVP Roger K. Maes, DVM, PhD Diagnostic Center for Population and Animal.

Food, Agricultural and Environmental Security Cook College New Jersey Agricultural Experiment Station.

Brian Murphy Environmental Education School District of Lee County Lee County Mosquito Control District Neil Wilkinson Florida Gulf Coast University.

Viral Encephalitis John Nuara, Salwa Touma, Kelly Wines Microbiology and the Control of Infectious Diseases April 22, 2003.

West Nile Virus Timeline  1937  First Case reported  1950  Virus studied in Egypt  1957  Outbreak in Israel  1960  Equine cases  1999  Appeared.

West Nile virus on the Prairies Tasha Epp, DVM, PhD October 5, 2010.

Iowa Climate Science Educators Forum Infectious Diseases - bugs and vector Dr. Yogi Shah MD, MPH Des Moines University.

July 2011 Indiana FCRV Disaster and Safety Awareness Training.

Krishna Thakur Hu Suk Lee Outline  Introduction  GIS questions?  Objectives  Materials and Methods  Results  Discussion  Conclusions.

+ Environmental Factors and Risk Areas of West Nile Virus in Southern California, 2007–2009 Hua Liu & Qihao Weng Ivonna Reda.

Bird Flu.  Bird flu, also known as Avian Influenza, is a type A influenza virus. It is fatal to humans. Bird flu spreads between both wild and pet birds.

AVIANAVIAN FLUFLU Ginny Codd Viruses: Infection and Ecology.

1 West Nile Virus Washington State Department of Health The 2004 Picture West Nile Virus.

ST 660 Special Session on ICBL Margaret Waterman Southeast Missouri State University Ethel Stanley Beloit College Investigative Cases: Engaging Students.

Protect your Family from West Nile Virus. West Nile virus West Nile virus Mosquito vector Incidental infections Bird reservoir hosts Incidental infections.

Global Antibiotic Use and the Rise of Resistance BioQUEST Summer Workshop June 12 – 13, 2010 Julie Seiter, Oakland Community College Ethel Stanley, BioQUEST,

Mosquito Season. Mosquito/West Nile Virus Link Over 50 types of mosquitoes thrive in Harris County West Nile virus (WNV) is a mosquito-borne virus It.

Veterinarians By : Paul Thomas Fischer. What do Veterinarians do Veterinarians are doctors for animals. They examine and care for animals, give them check.

 In 2001, CDC published an article in the Journal of Virology showing that a single dose of a DNA vaccine could prevent WNV infection in mice and horses.

INTRODUCTION TO INFLUENZA The (Ferret) Sneeze Heard Around The World: The Case Of The Bioengineered Bird Flu Case Study for AAC&U STIRS Project Jill M.

How serious is the threat of an Avian flu Human Pandemic Avian (Bird) December 2005.

Epidemic-Curve Graph (Top) and Field Position Diagram (Bottom) of Cases of MRSA Infection among St. Louis Rams Football Players in 2003 Kazakova, S. V.

Brian Murphy Environmental Education School District of Lee County Lee County Mosquito Control District Neil Wilkinson Florida Gulf Coast University.

Dry weather induces outbreaks of human West Nile virus infections Guiming Wang, Richard B. Minnis, Jerrold L. Belant, & Charles L. Wax.

Stephanie Hyman, MPH student Walden University PUBH Instructor: Dr. Howard Rubin Fall Qtr

August 11, 2008 Oakwood University Huntsville, AL Ethel Stanley, EdD BioQUEST Curriculum Consortium Beloit College Sam Donovan, PhD.

WEST NILE Felicia Henderson. HISTORY West Nile virus is an emerging infectious disease that was first discovered in the African country of Uganda in 1937,

Global Health Tom D. Y. Chin, MD, MPH. This lecture was given to the first year medical students at the University of Kansas School of Medicine in 2005.

West Nile Virus Kimberly Signs, DVM Michigan Department of Community Health.

Preparing for WNV: Montana’s Experience Jim Murphy, Health Specialist Montana Department of Public Health & Human Services (406)

Surveillance & Environmental Health West Nile Virus Seroprevalence: Results of Enhanced Surveillance Program.

Directed Reading: “Biology in Your World”

National Wildlife Health Center West Nile Virus What’s New in the Wildlife Arena? November 2003 What’s New in the Wildlife Arena? November 2003.

By the end of this lesson you will be able to Analyze diffusion patterns to understand, manage, and predict movement. Acquire an understanding of the.

A Quiz For Dad A test for your social studies skills on the topic of Judaism.

Updated 01/12/07 West Nile Virus Activity in California Counties 2007 YTD Counties with West Nile virus activity (number of human infections) Counties.

European Geosciences Union – General Assembly 2012, Vienna, Austria, 22 – 27 April 2012 Background of research After 1990 there were environmental changes.

 Mosquito  Horses  The warm months  dawn and dusk.  Hot, dry weather Reference: "West Nile Virus Information."

Section 21.4 Emerging Infectious Diseases Slide 1 of 15 Objectives Define the term emerging disease. Identify five reasons why diseases emerge. Section.

CHOOSE 1 OF THESE.

Dengue. Dengue cycle Aedes mosquitoes which reside in water-filled containers.

West Nile Virus Mira J. Leslie State Public Health Veterinarian Washington State Department of Health Epidemiology of the North American outbreak.

MGT 330 Week 3 Individual Management Planning Paper Boeing To purchase this material click on below link 330-Week-3-Individual-Management-Planning-Paper-

PSY 210 Week 1 DQ 2 Important factors to consider when taking your classes are how employers will view the skills you have developed during your college.

ESE 631 Week 6 Journal Course Reflections To purchase this material click below link ASH/ESE-631-Week-6-Journal-Course-

FIN 419 Week 5 DQ 2 What would you consider to be a global equivalent(s) to the SEC within the USA? Are there individual reporting requirements comparable?

Virus DHO chapter 14.

Copyright © 2017 American Academy of Pediatrics.

Biodiversity loss and the rise of zoonotic pathogens

The Global Threat of Epidemic Emergent- Re-Emergent Infectious Diseases: Lessons Learned and Prospects for the Future S. Machado Duane J Gubler Professor.

West Nile Virus Johnson 7.

CLICK TO GO BACK TO KIOSK MENU Correlation Coefficient

שילוב קורסים לפיתוח מיומנויות למידה במכללה להנדסה

Biodiversity loss and the rise of zoonotic pathogens

West Nile virus outbreak in Israel in 2015: phylogenetic and geographic characterization in humans and mosquitoes Y. Lustig, Z. Kaufman, B. Mannasse,

F. Magurano Clinical Microbiology and Infection

A. Papa, K. Xanthopoulou, S. Gewehr, S. Mourelatos

CLICK TO START.

CLICK TO START.

Serum ferritin levels in West Nile encephalitis

West Nile Virus By Robbie Bodnar.

Call Now : Click : -

Call Now : Click : -

Call Now : Click : -

Presentation transcript:

PEER: Skills for Success University of Tennessee-Knoxville West Nile Virus Ethel Stanley BioQUEST, Beloit College Sam Donovan University of Pittsburgh

Approximate global distribution of West Nile virus Solomon, T., Brit. Med. J. 326, (2003)

Clinical course of West Nile encephalitis Solomon, T., Brit. Med. J. 326, (2003)

Replication Note: After you click on the link above, choose USA and click GO ID=472 Vaccine m CDC- West Nile Virus in Farmed Alligators Predicting WNV Global Warming May Lead to More West Nile Virus global-warming

What are our questions?

“It’s called West Nile for a reason...”

> Stork98TTTAACTGCCTTGGAATGAGCAACAGAGACTTCTTGGAAGGAGTG TCTGGAGCAACATGGGTGGATTTGGTTCTCGAAGGCGACAGCTGCGTGAC TATCATGTCTAAGGACAAGCCTACCATCGATGTGAAGATGATGAATATGGAG GCGG >Goose99TTCAACTGCCTTGGAATGAGCAACAGAGACTTCTTGGAAGGAGTGTC TGGAGCAACATGGGTGGATTTGGTTCTCGAAGGCGACAGCTGCGTGACTATCA TGTCTAAGGACAAGCCTACCATCGATGTGAAGATGATG Malkinson,M., Banet,C., Weisman,Y., Pokamunski S, King,R., Drouet, M.T. and Deubel, V Introduction of West Nile virus in the Middle East. Journal Emerging Infect. Dis. 8 (4): Banet-Noach, C., Malkinson, M., Brill, A., Samina, I., Yadin, H., Weisman, Y., Pokamunski, S., King, R., Deubel, V. and Stram, Y Phylogenetic relationships of West Nile viruses isolated from birds and horses in Israel from 1997 to Journal Virus Genes 26 (2), But where did Israel-98 come from?

The stork brought it…