DTU - January Hanne Jarmer

Slides:



Advertisements
Similar presentations
Microarray Technique, Analysis, and Applications in Dermatology Jennifer Villaseñor-Park 1 and Alex G Ortega-Loayza 2 1 Department of Dermatology, University.
Advertisements

Application of available statistical tools Development of specific, more appropriate statistical tools for use with microarrays Functional annotation of.
Modeling sequence dependence of microarray probe signals Li Zhang Department of Biostatistics and Applied Mathematics MD Anderson Cancer Center.
Microarray Basics, and Planning a Microarray Experiment
Microarray Simultaneously determining the abundance of multiple(100s-10,000s) transcripts.
1 MicroArray -- Data Analysis Cecilia Hansen & Dirk Repsilber Bioinformatics - 10p, October 2001.
Microarray technology and analysis of gene expression data Hillevi Lindroos.
Statistics for Microarrays
Introduction to DNA Microarray Technology Steen Knudsen, April 2005.
T cells Jan Novák. The immune system Protection against infectious agents Clearance of dying, damaged and dangerous cells Regulation of the immune responses.
DNA microarray and array data analysis
DNA Microarray: A Recombinant DNA Method. Basic Steps to Microarray: Obtain cells with genes that are needed for analysis. Isolate the mRNA using extraction.
Microarray analysis Golan Yona ( original version by David Lin )
Class 6 DNA Arrays BIOMEMS, Fall Content u Polymerase Chain Reaction or PCR u DNA Detection Process u DNA Micro Arrays u Electronic DNA Arrays u.
The Human Genome Project and ~ 100 other genome projects:
Sample preparation 1. Design experiment Question? Replicates? Test? 2. Perform experiment 4. Label RNA Amplification? Direct or indirect? Label? wild.
DNA Arrays …DNA systematically arrayed at high density, –virtual genomes for expression studies, RNA hybridization to DNA for expression studies, –comparative.
Central Dogma 2 Transcription mRNA Information stored In Gene (DNA) Translation Protein Transcription Reverse Transcription SELF-REPAIRING ARABIDOPSIS,
Microarray Technology Types Normalization Microarray Technology Microarray: –New Technology (first paper: 1995) Allows study of thousands of genes at.
1 Characterization, Amplification, Expression Screening of libraries Amplification of DNA (PCR) Analysis of DNA (Sequencing) Chemical Synthesis of DNA.
Arrays: Narrower terms include bead arrays, bead based arrays, bioarrays, bioelectronic arrays, cDNA arrays, cell arrays, DNA arrays, gene arrays, gene.
Microarrays: Theory and Application By Rich Jenkins MS Student of Zoo4670/5670 Year 2004.
Introduce to Microarray
Introduction to Autoimmunity Alon Monsonego, Ph.D. The department of Microbiology and Immunology Tel:
Next Generation Microarray Technology: Overview of Febit’s Geniom One ® H. Bjørn Nielsen Center for Biological Sequence analysis Technical University of.
Introduction to DNA microarrays DTU - January Hanne Jarmer.
Genomics I: The Transcriptome RNA Expression Analysis Determining genomewide RNA expression levels.
GeneChips and Microarray Expression Data
and analysis of gene transcription
with an emphasis on DNA microarrays
Affymetrix vs. glass slide based arrays
DNA MICROARRAYS WHAT ARE THEY? BEFORE WE ANSWER THAT FIRST TAKE 1 MIN TO WRITE DOWN WHAT YOU KNOW ABOUT GENE EXPRESSION THEN SHARE YOUR THOUGHTS IN GROUPS.
Regulatory T Cells and Allergy
Data Type 1: Microarrays
Gene Expression Data Qifang Xu. Outline cDNA Microarray Technology cDNA Microarray Technology Data Representation Data Representation Statistical Analysis.
Introduction to DNA microarrays DTU - May Hanne Jarmer.
Microarray - Leukemia vs. normal GeneChip System.
Scenario 6 Distinguishing different types of leukemia to target treatment.
Doug Brutlag 2011 Genomics, Bioinformatics & Medicine Doug Brutlag Professor Emeritus of.
Microarrays and Gene Expression Analysis. 2 Gene Expression Data Microarray experiments Applications Data analysis Gene Expression Databases.
What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.
Genomics I: The Transcriptome
GeneChip® Probe Arrays
Topic intro slides More complete coverage of components involved in gene expression More information on expression technologies -what would the ideal chip.
MICROARRAY TECHNOLOGY
Gene Expression Analysis. 2 DNA Microarray First introduced in 1987 A microarray is a tool for analyzing gene expression in genomic scale. The microarray.
Introduction to Microarrays.
Th Cell Subsets Dale T. Umetsu, MD, PhD February 27, 2002 n The definition of the Th1/Th2 subsets. n Situations in which Th subsets important. n How do.
Whole Genome Approaches to Cancer 1. What other tumor is a given rare tumor most like? 2. Is tumor X likely to respond to drug Y?
Idea: measure the amount of mRNA to see which genes are being expressed in (used by) the cell. Measuring protein might be more direct, but is currently.
Introduction to Microarrays Kellie J. Archer, Ph.D. Assistant Professor Department of Biostatistics
Introduction to Microarrays. The Central Dogma.
Overview of Microarray. 2/71 Gene Expression Gene expression Production of mRNA is very much a reflection of the activity level of gene In the past, looking.
Microarray analysis Quantitation of Gene Expression Expression Data to Networks BIO520 BioinformaticsJim Lund Reading: Ch 16.
ANALYSIS OF GENE EXPRESSION DATA. Gene expression data is a high-throughput data type (like DNA and protein sequences) that requires bioinformatic pattern.
Microarrays.
Lecture 23 – Functional Genomics I Based on chapter 8 Functional and Comparative Genomics Copyright © 2010 Pearson Education Inc.
Microarrays and Other High-Throughput Methods BMI/CS 576 Colin Dewey Fall 2010.
DNA Microarray Overview and Application. Table of Contents Section One : Introduction Section Two : Microarray Technique Section Three : Types of DNA.
Transcriptome What is it - genome wide transcript abundance How do you obtain it - Arrays + MPSS What do you do with it when you have it - ?
Introduction to Oligonucleotide Microarray Technology
Microarray: An Introduction
Tolerance and Autoimmunity
The Central Dogma. Life - a recipe for making proteins DNA protein RNA Translation Transcription.
Functional Genomics in Evolutionary Research
Microarray Technology and Applications
Introduction to cDNA Microarray Technology
Introduction to Microarrays.
Getting the numbers comparable
Data Type 1: Microarrays
Presentation transcript:

DTU - January 2007 - Hanne Jarmer Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer

Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go RNA CELL

Why? RNA

gene specific DNA probes How? gene mRNA gene specific DNA probes labeled target

Microarrays - The Technologies Stanford-type Microarrays High-density

Stanford-type Microarrays

Stanford-type Microarrays Coating glass slides Deposition of probes Post-processing Hybridization

Spotting - Mechanical deposition of probes

16-pin microarrayer

Microarrayer

Stanford microarrays SAMPLE CONTROL mRNA cDNA Cy3-cDNA Cy5-cDNA

Affymetrix GeneChip® oligonucleotide array • 11 to 20 oligonucleotide probes for each gene On-chip synthesis of 25 mers ~20,000 genes per chip good quality data 280-500 K features to play with

Photolithography Mask #2 Mask #1 in situ synthesis T A Mask #2 Mask #1 T A Spacers bound to surface with photolabile protection groups

Sample Preparation - Eberwine RNA 42 C 2 h ssDNA + Reverse Transcriptase 70 C 10 min T7 + RNase H + Polymerase 16 C 2 h T7 pol clean up dsDNA dsDNA 37 C 6 h + Biotin-labeled nucleotides aRNA

Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-SAPE IgG biotinylated anti-anti IgG

The Affymetrix GeneChip® A gene is represented like this: PM MM - Perfect Match (PM) - MisMatch (MM) PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT

NimbleGen 385,000 to 2.1 mill features Long probes (up to 70 nt) Service: labelling scanning image analysis

Photolithography - Micromirrors

Analysis of Data Normalization: Linear or non-linear

Is it worth it? Known positives versus the total number of significantly affected genes at 5 different cutoffs in the TnrA experiment Number of known positives Qspline normalization Linear normalization Number of significantly affected genes

Analysis of Data Normalization: Linear or non-linear Statistical test: student’s t-test ANalysis Of VAriance (ANOVA) Analysis: Principal Component Analysis (PCA) Clustering and visualization

Tiling arrays Tiling arrays are used for determation of genes, ncRNAs, TF-binding sites, ...

Regulatory T Cells and Allergy Hanne Jarmer (CBS)

Type I Hypersensitivity A normal reaction against parasites Typical allergens: - pollen - penicillin - nuts - milk - bee venom - mold spores

Early Last Century Poul Portier and Charles Richet observed: Portuguese Man of War “Hmm..., maybe we can make a vaccine?”

Early last century

Immediate Hypersensitivity Richet got the Nobel Prize Early Last Century 1. time: No reaction 2. time: Got sick  died Immediate Hypersensitivity anaphylaxis Richet got the Nobel Prize

The Mechanism

The Regulation Several factors are important: - genetics presentation (concentration/mode) - TH1, TH2 and TReg

The Regulation TC TH1 TH2 TReg The Naive T cell will differentiate into different subsets induced by different cytokines Naive T cell Cytokines TH1 TH2 TReg TC

The Regulation Naive T cell IL-12 IL-4 IL-10 ? TH1 TReg TH2

CD4+ T cells - The normal state - Keeping the balance TH1 TH2 TReg

The allergic state - Out of balance TReg TH1 TH2

Three types of TReg cells CD25 TReg1 TReg2 TReg3 IL-10 TGF- CD25 = IL-2 receptor  (IL2RA)

CD25+ TReg cells Low proliferative capacity Immunoregulatory properties T cell homeostasis Prevents autoimmunity Antigen specific, cell-cell adhesion Induction of tolerance ... but how? Potential use in Immuno Specific Therapy (SIT) - graft tolerance ... or the other way around ... in vaccines or cancer treatment

Microarray Project The goal: Investigate the mechanism  find cure for allergy or an effective SIT The plan: Find the responsible genes by the use of carefully designed microarray experiments

The Microarray Experiments Blood from 5 normal and 5 allergic patients normal allergic normal CD4+CD25+ CD4+ allergic 20 microarrays

The Microarray Experiments 20 microarrays

1 2-way ANOVA 2 Normal Allergic Normal Allergic CD4+CD25+ CD4+CD25+

2-way ANOVA

The Regulatory T cell signal Natural Treg cells Nature Immunology  6, 345 - 352 (2005) Naturally arising Foxp3-expressing CD25+CD4+ regulatory T cells in immunological tolerance to self and non-self by Shimon Sakaguch

Fewer active TReg cells No tolerance Maybe ... CTLA-4 B7 X APC TReg (TCR MHC-II) Allergic TReg: Less X Fewer active TReg cells No tolerance

Thanks to Liu Anting, PhD from ALK ALK-abello Kristine Dahlin and Thomas Jensen