Overview JGIRASTManatee Length713010002 DescriptionThe Glug motifHalomucin [Precursor] Halomucin Table designed by Jay McNair.

Slides:

Advertisements

Similar presentations

20,000 GENES IN HUMAN GENOME; WHAT WOULD HAPPEN IF ALL THESE GENES WERE EXPRESSED IN EVERY CELL IN YOUR BODY? WHAT WOULD HAPPEN IF THEY WERE EXPRESSED.

Advertisements

CHAPTER 31 Genetic Engineering and Biotechnology.

Analysis of Xbp-mRNA RT-PCR. Polymerase Chain Reaction (PCR)

SRY Gene on Chromosome Y Jon Scales Genetics Fall GTAACAAAGAATCTGGTAGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCA 61 CCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATG.

Gene to Protein Part 2: Translation After the mRNA transcript leaves the nucleus it goes to a ribosome (site of protein synthesis).

Suplemental Data Figure S1. Alignment of deduced amino acid sequence of CaGA2ox1 and other GA2ox homologs from the pepper EST database. Dark shading indicates.

Chap. 5 Problem 1 Recessive mutations must be present in two copies (homozygous) in diploid organisms to show a phenotype (Fig. 5.2). These mutations show.

While replication, one strand will form a continuous copy while the other form a series of short “Okazaki” fragments Genetic traits can be transferred.

ESTs Ian Keller Laboratory Techniques in Molecular Bio.

The Genetic Code. The DNA that makes up the human genome can be subdivided into information bytes called genes. Each gene encodes a unique protein that.

Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.

Finding genes in the genome

Protein Synthesis Unit 2-6 Notes Mr. Hefti – Pulaski Biology.

Silencing of Nicotiana benthamiana NbRNP1 gene encoding U3 small nucleolar ribonucleoprotein affects leaf development by interference with ASYMMETRIC LEAVES.

Characterization of the Nicotiana benthamiana chromomethyltransferase genes, NbCMT3s, in leaf development by virus-induced gene silencing Abstract Results.

Functional characterization of the Nicotiana benthamiana chromomethyltransferase gene, NbCMT3, in developmental programs by virus-induced gene silencing.

Mahmuda Akter, Paige Fairrow-Davis, and Rebecca Seipelt-Thiemann

Supplemental Fig. S1 A B AtMYBS aa AtMYBS

Figure 1. RT–PCR identification of an abnormal transcript of the PTPN6 gene in normal and leukemic bone marrow cells and cell line. (a) Diagrammatic representation.

Figure 6: BTK splice variants in B cell precursor leukemia

Molecular Genetics Transcription & Translation

HOW PROTEINS ARE MADE BY THE CELL

Figure 1. Structure of the fly LGR2 gene and the corresponding cDNA sequence. A, Derivation of the fly LGR2 full-length cDNA from the genomic sequence.

Supplemental Figure 2. (A) AtplaIVA-1 and AtplaIVA-2 null transcription lines for AtPLAIVA mRNA. RNAs from the relevant wild type Col were isolated.

Figure 6. CtBP1 down‐regulates the expression of Axin2 in 293 cells

by Mark T. Boyd, Brian Foley, and Isadore Brodsky

The making of proteins for …..

by Nancy D. Borson, Martha Q. Lacy, and Peter J. Wettstein

Vav‐1 gene‐targeting strategy.

Mark M Metzstein, H.Robert Horvitz Molecular Cell

by Takashi Kasukabe, Junko Okabe-Kado, and Yoshio Honma

Consequences of T‐DNA insertion on SWP expression in swp mutant.

IgA and IgM VH repertoires in human colon: Evidence for clonally expanded B cells that are widely disseminated Wolfgang Holtmeier, Andreas Hennemann,

Chapter 4 The Interrupted Gene.

High incidence of somatic mutations in the AML1/RUNX1 gene in myelodysplastic syndrome and low blast percentage myeloid leukemia with myelodysplasia by.

A: OAZ1 mRNA transcript of 775-1, and parental cell lines showing the stop codon introduced by the nonsense mutations in the and transcripts,

Volume 129, Issue 3, Pages (May 2007)

Essential Question: How cells make proteins

Volume 84, Issue 3, Pages (February 1996)

Catherine E. Keegan, Anthony A. Killeen

Volume 10, Issue 2, Pages (February 1999)

Posttranslational Regulation of Ca2+-Activated K+ Currents by a Target-Derived Factor in Developing Parasympathetic Neurons Priya Subramony, Sanja Raucher,

Volume 93, Issue 7, Pages (June 1998)

Volume 64, Issue 4, Pages (October 2003)

Size Polymorphisms in the Human Ultrahigh Sulfur Hair Keratin-Associated Protein 4, KAP4, Gene Family Naoyuki Kariya, Yutaka Shimomura, Masaaki Ito

Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2

Volume 10, Issue 8, Pages (April 2000)

Identification of COL7A1 Alternative Splicing Inserting 9 Amino Acid Residues Into the Fibronectin Type III Linker Domain Daisuke Sawamura, Maki Goto,

A Presenilin-1 Truncating Mutation Is Present in Two Cases with Autopsy-Confirmed Early-Onset Alzheimer Disease Carolyn Tysoe, Joanne Whittaker, John.

The PHANTASTICA Gene Encodes a MYB Transcription Factor Involved in Growth and Dorsoventrality of Lateral Organs in Antirrhinum Richard Waites, Harinee.

The abcc6a Gene Expression Is Required for Normal Zebrafish Development Qiaoli Li, Sara Sadowski, Michael Frank, Chunli Chai, Andras Váradi, Shiu-Ying.

Volume 107, Issue 4, Pages (November 2001)

Characterization and Mutation Analysis of Human LEFTY A and LEFTY B, Homologues of Murine Genes Implicated in Left-Right Axis Development K. Kosaki,

Assessing the Functional Characteristics of Synonymous and Nonsynonymous Mutation Candidates by Use of Large DNA Constructs A.M. Eeds, D. Mortlock, R.

Identification of the GCS1 ortholog in Gonium pectorale.

Correction of Gene Annotation and Other Sequence Analysis of Arabidopsis Proteins Identified on the 2-D Gels in Figure 1.(A) Spot 71, identified as a 17.2-kD.

Shifty Ciliates Lawrence A. Klobutcher, Philip J. Farabaugh Cell

Volume 21, Issue 7, Pages (July 2014)

Fig. 4. transparent encodes Mpv17.(A) tra maps to chromosome 20.

Barc knockdown causes intron retention of short, GC-rich introns with weak splice sites. barc knockdown causes intron retention of short, GC-rich introns.

(A) yellow cDNA comparison among wild-type and ch mutants

Identification of Skn-1n, a Splice Variant Induced by High Calcium Concentration and Specifically Expressed in Normal Human Keratinocytes Koji Nakajima,

Fig. 2 Overview of transcriptional mutagenesis in yeast.

Validation and pathway enrichment analysis of genes rescued by DM-α-KG treatment of rho0 cells based on microarray experiments. Validation and pathway.

Mutation of the Ca2+ Channel β Subunit Gene Cchb4 Is Associated with Ataxia and Seizures in the Lethargic (lh) Mouse Daniel L Burgess, Julie M Jones,

Volume 66, Issue 1, Pages (July 2004)

Adam T. McGeoch, Stephen D. Bell Cell

The NB-ARC domain: a novel signalling motif shared by plant resistance gene products and regulators of cell death in animals Erik A. van der Biezen,

Predicted Amino Acid Sequence of the Tomato Cf-4 Protein (Thomas et al

Domain structure of TLR2 (A) and Nod2 (B).

Presentation transcript:

Overview JGIRASTManatee Length DescriptionThe Glug motifHalomucin [Precursor] Halomucin Table designed by Jay McNair

gth_Histograms

GLUG Motif

GV PHB Electron Tomographic image of a single square cell of Haloquadratum walsbyi /7/169

D M M bp M M bp D M M bp M M bp H. walsbyi encodes halomucin, an extremely large protein homologous to mammalian mucins. GC content (C) and gene organization (B) of a bp long region of the genome of H. walsbyi. This region contains the large, high GC gene encoding halomucin (hmu1) and the two capsular protein biosynthesis genes capC and capB. The domain organization of halomucin (A) reveals domains typically found in mammalian mucins. The letters D, S, V, G, and L indicate domains enriched for the corresponding amino acids. Halomucin expression is shown by detection of its mRNA via RT-PCR (D). cDNA was prepared by reverse transcription using primer sets numbered 1 to 7 the position of which correspond to the striped and numbered boxes in the hmu1 gene (B).

tblastx Resuts 3 frameshifts mentioned in halomucin paper