Data Workflow Overview Genomics High- Throughput Facility Genome Analyzer IIx Institute for Genomics and Bioinformatics Computation Resources Storage Capacity.

Slides:

Advertisements

Similar presentations

Before we start Login to the laptop: user: crgcomu Password: crgcomu Login to the network: Wifi: carretwifi Password : Login to galaxy (ldap):

Advertisements

Vanderbilt Center for Quantitative Sciences Summer Institute Sequencing Analysis Yan Guo.

IMGS 2012 Bioinformatics Workshop: RNA Seq using Galaxy

Differentially expressed genes Sample class prediction etc.

GCC Genomics Core Computing. Current situation GCC 1.0 Roche 454 Current cluster UZ network 8C 16Gb 2TB UZ NAS Storage 8C 16Gb Per run: ~ 1 Mio reads.

Dawei Lin, Ph.D. Director, Bioinformatics Core UC Davis Genome Center July 20, 2008, SLIMS (Solexa sequencing.

Title US-CMS User Facilities Vivian O’Dell US CMS Physics Meeting May 18, 2001.

RNA-seq Analysis in Galaxy

The University of Texas Research Data Repository : “Corral” A Geographically Replicated Repository for Research Data Chris Jordan.

The iPlant Collaborative Community Cyberinfrastructure for Life Science Tools and Services Workshop Discovery Environment Overview.

Before we start: Align sequence reads to the reference genome

NGS Analysis Using Galaxy

An Introduction to RNA-Seq Transcriptome Profiling with iPlant

DRAW+SneakPeek: Analysis Workflow and Quality Metric Management for DNA-Seq Experiments O. Valladares 1,2, C.-F. Lin 1,2, D. M. Childress 1,2, E. Klevak.

Introduction to RNA-Seq and Transcriptome Analysis

LECTURE 2 Splicing graphs / Annoteted transcript expression estimation.

The BioBox Initiative: Bio-ClusterGrid Gilbert Thomas Associate Engineer Sun APSTC – Asia Pacific Science & Technology Center.

Bioinformatics Core Facility Ernesto Lowy February 2012.

Genomics Virtual Lab: analyze your data with a mouse click Igor Makunin School of Agriculture and Food Sciences, UQ, April 8, 2015.

Computer Lab (I) Introduction of galaxy and UCSC genome browser.

RNAseq analyses -- methods

DDN & iRODS at ICBR By Alex Oumantsev History of ICBR  Campus wide Interdisciplinary Center for Biotechnology Research  Core Facility  Funded by the.

NCICB Systems Architecture Bill Britton Terrapin Systems LPG/NCICB Dedicated Support.

is accessible at: The following pages are a schematic representation of how to navigate through ALE-HSA21.

High Throughput Sequence (HTS) data analysis 1.Storage and retrieving of HTS data. 2.Representation of HTS data. 3.Visualization of HTS data. 4.Discovering.

RNA-Seq 2013, Boston MA, 6/20/2013 Optimizing the National Cyberinfrastructure for Lower Bioinformatic Costs: Making the Most of Resources for Publicly.

NGS data analysis CCM Seminar series Michael Liang:

Next Generation DNA Sequencing

Next Generation Sequencing. Overview of RNA-seq experimental procedures. Wang L et al. Briefings in Functional Genomics 2010;9: © The Author.

RNA-Seq in Galaxy Igor Makunin QAAFI, Internal Workshop, April 17, 2015.

An Introduction to RNA-Seq Transcriptome Profiling with iPlant.

Introductory RNA-seq Transcriptome Profiling. Before we start: Align sequence reads to the reference genome The most time-consuming part of the analysis.

Introduction to RNA-Seq

Current Challenges in Metagenomics: an Overview Chandan Pal 17 th December, GoBiG Meeting.

Public Relations Interim Image Archive Goal: Provide and INTERIM image archive solution for Public Relations 2 to 4 TB of images currently spread across.

Sackler Medical School

Cloud Implementation of GT-FAR (Genome and Transcriptome-Free Analysis of RNA-Seq) University of Southern California.

IPlant Collaborative Hands-on Cyberinfrastructure Workshop - Part 1 R. Walls University of Arizona Biodiversity Information Standards (TDWG) Sep. 28, 2015,

Genetics 760: Genomic Methods for Genetic Analysis Course Organizer: Jim TAs: Tim

Introductory RNA-seq Transcriptome Profiling. Before we start: Align sequence reads to the reference genome The most time-consuming part of the analysis.

RNA-Seq Transcriptome Profiling. Before we start: Align sequence reads to the reference genome The most time-consuming part of the analysis is doing the.

Accessing Evitech network via FTP by Susan Jansson.

Bioinformatics for biologists Dr. Habil Zare, PhD PI of Oncinfo Lab Assistant Professor, Department of Computer Science Texas State University Presented.

1 Adventures in Web Services for Large Geophysical Datasets Joe Sirott PMEL/NOAA.

The iPlant Collaborative

An Introduction to RNA-Seq Transcriptome Profiling with iPlant (

The iPlant Collaborative

RNA-Seq in Galaxy Igor Makunin DI/TRI, March 9, 2015.

Website Design:. Once you have created a website on your hard drive you need to get it up on to the Web. This is called "uploading“ or “publishing” or.

Manuel Holtgrewe Algorithmic Bioinformatics, Department of Mathematics and Computer Science PMSB Project: RNA-Seq Read Simulation.

UCSC Genome Browser Zeevik Melamed & Dror Hollander Gil Ast Lab Sackler Medical School.

RDA Data Support Section. Topics 1.What is it? 2.Who cares? 3.Why does the RDA need CISL? 4.What is on the horizon?

Network Services. Domain Controllers: – Used for Account management (e.g. user accounts, group accounts Register Hardware like Printers and PC Authentication.

+ Vieques and Your Computer Dan Malmer & Joey Azofeifa.

Canadian Bioinformatics Workshops

Canadian Bioinformatics Workshops

High Throughput Sequence (HTS) data analysis 1.Storage and retrieving of HTS data. 2.Representation of HTS data. 3.Visualization of HTS data. 4.Discovering.

JAX: Exploring The Galaxy Glen Beane, Senior Software Engineer.

CyVerse Workshop Discovery Environment Overview. Welcome to the Discovery Environment A Simple Interface to Hundreds of Bioinformatics Apps, Powerful.

GeneConnect Use Cases and Design August 3, GeneConnect Database IDs are linked by Direct Annotation, Inferred Annotation, or Sequence Alignment.

Canadian Bioinformatics Workshops

Cancer Genomics Core Lab

Customizing Galaxy for a Hospital Environment

CyVerse Discovery Environment

High-Throughput Analysis of Genomic Data [S7] ENRIQUE BLANCO

Storing and Accessing G-OnRamp’s Assembly Hubs outside of Galaxy

Transcriptomics Data Visualization Using Partek Flow Software

Overview of the ChIP‐Atlas data set and computational processing

Computer Networks Protocols

Presentation transcript:

Data Workflow Overview Genomics High- Throughput Facility Genome Analyzer IIx Institute for Genomics and Bioinformatics Computation Resources Storage Capacity Public Web Servers ● ~ 800 processors ● Sun Grid Engine ● ~ 100TB (secured) ● Fast drives ● 30TB for HTS ● HTTP, FTP ● Dedicated hosts ● User accounts HTS: 700GB/day Bandwidth: 10Gb/s USER Sample Analysis Requests (via web interface) Analysis Results (FTP server)

Data Analysis Workflow IMAGES 2-4 TB INTENSITIES GB Image Analysis Firecrest Base Calling Bustard BASE CALLS GB SEQUENCES + SCORES 20/30 GB Synthesis Gerald GENOME ALIGNMENT >100 GB Alignment ELAND + Reference Genome READ COUNTS Read Counting Casava VDC Sample-Specific Analysis, Visualization… e.g. Genome alignment, RNAseq, CHIPseq analysis Downloadable files for HTS users FASTQ files

Sequences, Scores ATATTCTTATATAAAAATATAATTATTTTAATATTTGGTCCTTTCGTACTAAAATAT +HWUSI-EAS1562_0001:8:1:1119:18138#0/1 AGAAAGCTTTGAAAATTATGTATACGCCTCGTAAGCCCAGTCCAAAGTCAAGACCA +HWUSI-EAS1562_0001:8:1:1119:13476#0/1 a_^`a`_a[[NOONN__V__`Y^`^X]R[]]]]]Q```Y````__`^W`YVUPR]] Sequence identifierRaw Sequence Phred base calling quality scores (0 to 62 encoded using ASCII 64 to 126)

Genome Alignment (ELAND) HWUSI-EAS1562_0001:8:1:1119:18138#0/1 ATATTCTTATATAAAAATATAATTATTTT AATATTTGGTCCTTTCGTACTAAAATAT U chr1.fa F 23G HWUSI-EAS1562_0001:8:1:1119:13476#0/1 AGAAAGCTTTGAAAATTATGTATACGCC TCGTAAGCCCAGTCCAAAGTCAAGACCA U chr12.fa F Sequence identifier Raw Sequence Type of match Number of exact/1-error/2-error matches Chromosome/Position/Direction Substitution

Read Counts (Casava VDC) Matchs with Genes, Exons, Splice junctions ChromosomeGeneMatchs Files for visualization (GenomeStudio) Genome alignment, Gene expression, RNAseq and CHIPseq analysis