Cell cycle regulation of DNMT1 and cancer

M M M M M M M M DNMT1 M M M M M M M M G0/G1SG2M DNMT1 transcription Enzymatic activity Steady state mRNA The Genome and Epigenome Must be Faithfully Replicated with Each Cell Cycle

Expression of DNMT1 mRNA is regulated with the cell cycle

CTTTGTGCATTCTGrattusutr( )( ) daniorarioutr( ) chickenutr( ) AATTTTAA mouseutr( )( ) GATTTTAAAAGTTTTTTATTATGCATTATATCAAATCTAChumanutr( ) AATTTTAA---TTTTTTATTCTGTATTCTATCAGATCTGCrattusutr( )( ) GTTTTTATdaniorarioutr( ) ACTTTATGTAGTTTTTATchickenutr( ) AGACTTGATGTAGTTNTTATmouseutr( )( ) CACTGTATGAGTGGAAATTAAGACTTTAT Arattusutr( )( ) daniorarioutr( ) chickenutr( ) mouseutr( )( ) AAAAAAAAAAAAAAAAAAAAAAAAAAhumanutr( ) rattusutr( )( ) daniorarioutr( ) chickenutr( ) GTGTAGTACTTTGTGCATTCTGmouseutr( )( ) TGATTTAGTGATCAAATTGTGCAGTACTTTGTGCATTCTGhumanutr( ) The DNMT1 3’UTR Contains A Highly Conserved Element

5’ 3’ 3’UTR probes / competitors UTR  3’- 158 UTR  3’- 56 UTR  5’ h 20h serum induced kDa serum induction (h) competitor: kDa none UTR UTR  3 ’56 UTR  3’ 158 UTR  5’ 259 A Specific Protein (p40) Binds the Conserved Region of the DNMT1 3’UTR in Arrested Cells

a aa ‭ ‬ a a a a ‭‬ DNMT1 3’UTR destabilizes mRNA in arrested cells t1/2=105 min t1/2=58 min serum arrested 56 nt

growth arrested serum induced (20h) DNMT1 GFP  DNMT1  UTR DNMT1 UTR DNMT1  UTR DNMT1 UTR  56 DNMT1 growth arrested serum induced (20h) Normalized DNMT1 mRNA pAD-DNMT-1 Kan DNMT1 DNMT1-UTR  56 DNMT1  UTR CMV polyA GFP The Highly Conserved Region of the 3’UTR is Required to Downregulate the DNMT1 mRNA in Growth Arrested Cells DNMT1  UTR DNMT1 UTR 56 

h-DNMT1 h-DNMT1-  3’UTR NIH 3T3 Deregulated cell cycle expression of DNMT1 leads to cellular transformation

The 3’UTR inhibits ectopic expression of DNMT1 at the G0 phase of the cell cycle Ectopic expression of DNMT1 induces entry into the S phase of the cell cycle

Mitogenic signals DNMT1 DNA replication Fig. 2 DNA replicationDNA methylation Protection of the DNA methylation pattern

Inhibition of DNMT1 by antisense oligonucleotides inhibits Y1 tumor growth in vivo

Nancy Detich QiangLi Zhuang Nadia Cervoni Ian Weaver Michael Meany