Genome Annotation Haixu Tang School of Informatics

Genome and genes Genome: an organism’s genetic material (Car encyclopedia) Gene: a discrete units of hereditary information located on the chromosomes and consisting of DNA. (Chapters to make components of a car, or to use and drive a car).

Gene Prediction: Computational Challenge aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaa tgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgc taagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt taccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaa tggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctggga tccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcc gatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggat ccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcct gcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatcc gatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatat gctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctggga tccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcc gatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgc ggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaat gcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgct aagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaat ggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggc tatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctat gctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgc ggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctg cggctatgctaatgcatgcggctatgctaagctcatgcgg

Gene Prediction: Computational Challenge aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaa tgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgc taagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt taccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaa tggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctggga tccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcc gatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggat ccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcct gcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatcc gatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatat gctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctggga tccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcc gatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgc ggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaat gcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgct aagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaat ggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggc tatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctat gctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgc ggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctg cggctatgctaatgcatgcggctatgctaagctcatgcgg

Gene Prediction: Computational Challenge aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaa tgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgc taagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt taccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaa tggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctggga tccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcc gatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggat ccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcct gcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatcc gatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatat gctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctggga tccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcc gatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgc ggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaat gcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgct aagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaat ggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggc tatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctat gctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgc ggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctg cggctatgctaatgcatgcggctatgctaagctcatgcgg Gene!

Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Gene Prediction: Computational Challenge

Protein RNA DNA transcription translation CCTGAGCCAACTATTGATGAA PEPTIDEPEPTIDE CCUGAGCCAACUAUUGAUGAA Central Dogma: DNA -> RNA -> Protein

Codon: 3 consecutive nucleotides 4 3 = 64 possible codons Genetic code is degenerative and redundant –Includes start and stop codons –An amino acid may be coded by more than one codon (codon degeneracy) Translating Nucleotides into Amino Acids

In 1961 Sydney Brenner and Francis Crick discovered frameshift mutations Systematically deleted nucleotides from DNA –Single and double deletions dramatically altered protein product –Effects of triple deletions were minor –Conclusion: every triplet of nucleotides, each codon, codes for exactly one amino acid in a protein Codons

UAA, UAG and UGA correspond to 3 Stop codons that (together with Start codon ATG) delineate Open Reading Frames Genetic Code and Stop Codons

Six Frames in a DNA Sequence stop codons – TAA, TAG, TGA start codons - ATG GACGTCTGCTTTGGAGAACTACATCAACCGGACTGTGGCTGTTATTACTTCTGATGGCAGAATGATTGTG CTGCAGACGAAACCTCTTGATGTAGTTGGCCTGACACCGACAATAATGAAGACTACCGTCTTACTAACAC GACGTCTGCTTTGGAGAACTACATCAACCGGACTGTGGCTGTTATTACTTCTGATGGCAGAATGATTGTG CTGCAGACGAAACCTCTTGATGTAGTTGGCCTGACACCGACAATAATGAAGACTACCGTCTTACTAACAC

Detect potential coding regions by looking at ORFs –A genome of length n is comprised of (n/3) codons –Stop codons break genome into segments between consecutive Stop codons –The subsegments of these that start from the Start codon (ATG) are ORFs ORFs in different frames may overlap Genomic Sequence Open reading frame ATGTGA Open Reading Frames (ORFs)

Long open reading frames may be a gene –At random, we should expect one stop codon every (64/3) ~= 21 codons –However, genes are usually much longer than this A basic approach is to scan for ORFs whose length exceeds certain threshold –This is naïve because some genes (e.g. some neural and immune system genes) are relatively short Long vs.Short ORFs

Testing ORFs: Codon Usage Create a 64-element hash table and count the frequencies of codons in an ORF Amino acids typically have more than one codon, but in nature certain codons are more in use Uneven use of the codons may characterize a real gene This compensate for pitfalls of the ORF length test

Codon Usage in Human Genome

AA codon /1000 frac Ser TCG Ser TCA Ser TCT Ser TCC Ser AGT Ser AGC Pro CCG Pro CCA Pro CCT Pro CCC AA codon /1000 frac Leu CTG Leu CTA Leu CTT Leu CTC Ala GCG Ala GCA Ala GCT Ala GCC Gln CAG Gln CAA Codon Usage in Mouse Genome

Transcription in prokaryotes Coding region Promoter Transcription start side Untranslated regions Transcribed region start codon stop codon 5’ 3’ upstream downstream Transcription stop side

Microbial gene finding Microbial genome tends to be gene rich (80%-90% of the sequence is coding sequence) Major problem – finding genes without known homologue.

Open Reading Frame Open Reading Frame (ORF) is a sequence of codons which starts with start codon, ends with a stop codon and has no stop codons in-between. Searching for ORFs – consider all 6 possible reading frames: 3 forward and 3 reverse Is the ORF a coding sequence? 1.Must be long enough (roughly 300 bp or more) 2.Should have average amino-acid composition specific for a given organism. 3.Should have codon usage specific for the given organism.

Gene finding using codon frequency frequency in coding regionfrequency in non-coding region Input sequence Compare Coding region or non-coding region

Example Codon position ACTG 128%33%18%21% 232%16%21%32% 333%15%14%38% frequency in genome 31%18%19%31% Assume: bases making codon are independent P(x|in coding) P(x|random) =  P(Ai at ith position) P(Ai in the sequence) i Score of AAAGAT:.28*.32*.33*.21*.26*.14.31*.31*.31*.31*.31*.19

Using codon frequency to find correct reading frame Consider sequence x 1 x 2 x 3 x 4 x 5 x 6 x 7 x 8 x 9…. where x i is a nucleotide let p 1 = p x1 x2 x3 p x3 x4 x5 …. p 2 = p x2 x3 x4 p x5 x6 x7 …. p 3 = p x3 x4 x5 p x6 x7 x8 …. then probability that ith reading frame is the coding frame is: p i p 1 + p 2 + p 3 Algorithm: slide a window along the sequence and compute P i Plot the results P i =

Eukaryotic gene finding On average, vertebrate gene is about 30KB long Coding region takes about 1KB Exon sizes vary from double digit numbers to kilobases An average 5’ UTR is about 750 bp An average 3’UTR is about 450 bp but both can be much longer.

Exons and Introns In eukaryotes, the gene is a combination of coding segments (exons) that are interrupted by non-coding segments (introns) This makes computational gene prediction in eukaryotes even more difficult Prokaryotes don’t have introns - Genes in prokaryotes are continuous

Gene Structure

Gene structure in eukaryotes Promoter Transcription start side Untranslated regions Transcribed region start codon stop codon 5’ 3’ Transcription stop side exons Initial exon Final exon donor and acceptor sides GT AG

Central Dogma and Splicing exon1 exon2exon3 intron1intron2 transcription translation splicing exon = coding intron = non-coding

Splicing Signals Exons are interspersed with introns and typically flanked by GT and AG

Splice site detection 5’ 3’ Donor site Position %

Consensus splice sites Donor: 7.9 bits Acceptor: 9.4 bits

Promoters Promoters are DNA segments upstream of transcripts that initiate transcription Promoter attracts RNA Polymerase to the transcription start site 5’ Promoter 3’

Statistical: coding segments (exons) have typical sequences on either end and use different subwords than non-coding segments (introns). Similarity-based: many human genes are similar to genes in mice, chicken, or even bacteria. Therefore, already known mouse, chicken, and bacterial genes may help to find human genes. Two Approaches to Eukaryotic Gene Prediction

Ribosomal Binding Site

( Donor: 7.9 bits Acceptor: 9.4 bits (Stephens & Schneider, 1996) Donor and Acceptor Sites: Motif Logos

Similarity-based gene finding Alignment of –Genomic sequence and (assembled) EST sequences –Genomic sequence and known (similar) protein sequences –Two or more similar genomic sequences

Cell or tissue Isolate mRNA and Reverse transcribe into cDNA Clone cDNA into a vector to Make a cDNA library 5’ 3’ EST Pick a clone And sequence the 5’ and 3’ Ends of cDNA insert dbEST Submit To dbEST Vectors Expressed Sequence Tags

Central Dogma and Splicing exon1 exon2exon3 intron1intron2 transcription translation splicing exon = coding intron = non-coding

Splicing Sequence Alignment Potential splicing sites

Using Similarities to Find the Exon Structure Human EST (mRNA) sequence is aligned to different locations in the human genome Find the “best” path to reveal the exon structure of human gene EST sequence Human Genome

An annotated gene in human genome