Fall 2006

Electrophoresis is a molecular technique that separates nucleic acids and proteins based on Size and +-+ Charge +-+

DNA is a negatively charged molecule and therefore is attracted to positive charges.

Agarose provides a matrix through which DNA molecules migrate. Size – larger molecules move through the matrix slower than small molecules Concentration – the higher the concentration of agarose, the better the separation of small fragments

Vector – DNA source which can replicate and is used to carry foreign genes or DNA fragments. Lambda phage Plasmid Recombinant DNA – A vector that has taken up a foreign piece of DNA.

Restriction enzyme – an enzyme which binds to DNA at a specific base sequence and then cuts the DNA.

Restriction enzymes are named after the bacteria from which they were isolated. a.Bacteria use restriction enzymes to “chop up” foreign viral DNA.

Recognition site – specific base sequence on DNA where a restriction enzyme binds. a.All recognition sites are palindromes, which means they read the same way forward and backward. (example: RACECAR orGAATTC CTTAAG b.Each restriction enzyme has its own unique recognition site.

Restriction enzymes cut in the middle of the recognition site. a.When restriction enzymes cut down the middle of the sequence, blunt ends are generated. Example: GATC GA + TC CTAG CT AG b.When restriction enzymes cut in a zig zag pattern, sticky ends are generated. Example: GAATTC G + AATTC CTTAAG CTTAAG G

i.Sticky ends are very useful because if two different pieces of DNA are cut with the same restriction enzyme, the overhanging sticky ends will complementarily base pair, creating a recombinant DNA molecule. ii.DNA ligase will seal the nick in the phosphodiester backbone.

After cutting up a long piece of DNA, you can run the samples on an agarose gel. a.The smaller fragments migrate further than the longer fragments. b.The bands are compared to standard DNA of known sizes. This is often called a DNA marker, or a DNA ladder.

After analyzing your results, you draw a restriction map of the cut sites. a.A restriction map is a diagram of DNA showing the cut sites of a series of restriction enzymes.

Bacterial Transformation – bacteria take up and express foreign DNA, usually a plasmid. Plasmid – circular piece of DNA

Steps of Bacterial Transformation 1.Choose a bacterial host. a.E.coli is a model organism. i.Well studied ii.No nuclear membranes iii.Has enzymes necessary for replication DNA/ Chrom.

Steps of Bacterial Transformation 2. Choose a plasmid to transform. a.Characteristics of a useful plasmid. i.Single recognition site Plasmid only cuts in one place, so this ensures that the plasmid is reformed in the correct order. ii.Origin of replication Allows plasmid to replicate and make copies for new cells. iii.Marker genes Identifies cells that have been transformed.  gene for antibiotic resistance – bacteria is plated on media with an antibiotic, and only bacteria that have taken up a plasmid will grow  gene that expresses color – bacteria that have taken up a recombinant plasmid are a different color than bacteria that have taken up a NONrecombinat vector.

Steps of Bacterial Transformation 3. Prepare bacterial cells for transformation of plasmid. a.Treat with calcium chloride, which allows plasmid to pass through bacterial cell walls. This is the most common method. b.Electroporation - brief electric pulse c.Directly inject plasmid into bacterial cell.

Steps of Bacterial Transformation 4. Plate transformation solution on appropriate media. a.Contains nutrients for bacteria. b.Contains antibiotic to distinguish transformed bacteria from NONtransformed bacteria. 5. Incubate plates overnight. a.E.coli grows in the human body, and is therefore incubated at body temperature (37°C) 6. Analyze plates.

Chromosome Walking

POLYMERASE CHAIN REACTION "PCR has transformed molecular biology through vastly extending the capacity to identify, manipulate and reproduce DNA. It makes abundant what was once scarce -- the genetic material required for experimentations."

The purpose of PCR is to amplify small amounts of DNA to produce enough for analysis.

Reaction Requirements Template – starting amount of DNA Target – segment of DNA you wish to amplify

Reaction Requirements Primers – short pieces of single stranded DNA that binds to the template DNA. Allows DNA polymerase to to attach and begin replication. 3’-TACGACCCGGTGTCAAAGTTAGCTTAGTCA-5’ 5’-ATGCTGGGCCACAGTTTCAATCGAATCAGT-3’ 5’-ATGCT-3’ 3’-AGTCA-5’

Reaction Requirements Polymerase – attaches nucleotides to the template. Taq polymerase is extracted from bacteria that live in hot springs, so they remain active at temperatures up to 90°C. 3’-TACGACCCGGTGTCAAAGTTAGCTTAGTCA-5’ 5’-ATGCTGGGCCACAGTTT-3’ 5’-ATGCTGGGCCACAGTTTCAATCGAATCAGT-3’ 3’- AAGTTAGCTTAGTCA-5’

Reaction Requirements Magnesium – required for DNA polymerase to work Nucleotides – needed to make new DNA segments Buffer – maintain constant pH Thermocycler – machine that cycles through required temperatures

STEPS: 1.Heat samples to 90°C for a minute or so to separate double stranded template DNA.

STEPS: 2. Drop temperature to around 50 or 60°C to allow primers to anneal.

STEPS: 3. Maintain temperature at 70°C for a minute or two to allow the polymerase to elongate the new DNA strands.

4. Repeat denaturation, annealing, and synthesis steps over and over and over.

* PCR amplification is logarithmic, meaning the number of copies is doubled with every cycle.

Human Genome Project

Francis Collins Craig Venter

Who owns your DNA?

Automated Sequencing G labeled with blue dye A labeled with red dye T labeled with green dye C labeled with black dye

Medicine

Evolutionary Biology

Now what?????? The Genome is mapped…. Now what??????

<>

Southern Blotting Developed by Edward Southern. Hybridization technique in which a DNA probe binds to DNA. Used to determine if a specific DNA sequence is present in a sample or where a band containing a specific sequence is located on a gel.

Procedure for Southern Blotting 1.Cut genomic DNA with restriction enzymes and run on an agarose gel.

Procedure for Southern Blotting 2. Transfer DNA to a nylon membrane.

Procedure for Southern Blotting 3.Hybridize a DNA probe to specific sequences on the membrane. The probe will only bind if it is complementary to the DNA sequence. GATCCGCTATGTGGGCTGAC GGCGATACAC

Procedure for Southern Blotting 4. You will only visualize bands where the probe has hybridized to the DNA.