DNA Profiling (DNA fingerprinting) pard/cleared.html

What is DNA Profiling? A technique used by scientists to distinguish between individuals of the same species using only samples of their DNA. Invented in 1985.

Stages of DNA Profiling Stage 1: Cells are broken down to release DNA (DNA extraction) If only a small amount of DNA is available it can be amplified using the polymerase chain reaction (PCR)

Stages of DNA Profiling Step 2: The DNA is cut into fragments using different restriction enzymes. Each restriction enzyme cuts DNA at a specific base sequence. The sections of DNA that are cut out are called restriction fragments.

Stages of DNA Profiling This yields many restriction fragments of all different sizes because the base sequences being cut may be far apart (long fragment) or close together (short fragment). Restriction enzymes can cut at coding regions (genes which code for proteins) or non-coding regions About 99.5% of our DNA is the same –at the coding regions (if different= mutation). We differ in our non-coding regions.

VNTRs In non-coding regions, variations in variable number tandem repeats (VNTRs) may exist. This will produce different # of fragments when DNA is cut with restrictions enzymes.

Imagine DNA cut with restriction enzyme that recognized CC ↓ GG Person #1 AATATACCGGATATTTTATATTTTATATTTTCCGGTT Person #2 AATATACCGGATATTTTATATTTTCCGGTTACCGGTT Fragments generated by Person #1Fragments generated by Person #2 8 bp, 25 bp, 4 bp8 bp, 18 bp, 7 bp, 4 bp

Stages of DNA Profiling Stage 3: Fragments are separated on the basis of size using a process called gel electrophoresis. DNA fragments are injected into wells and an electric current is applied along the porous gel.

Stages of DNA Profiling DNA is negatively charged so it is attracted to the positive end of the gel. The shorter DNA fragments move faster than the longer fragments. DNA is separated on basis of size.

Stages of DNA Profiling Stage 4:  The gel is stained with ethidium bromide which combines with the DNA fragments to produce a fluorescent image. Stage 5:  The stained gel is exposed to UV light, photographed and the distribution of fragments is analysed.

In this example, a family consists of a mom and dad, two daughters and two sons. The parents have one daughter and one son together, one daughter is from the mother’s previous marriage, and one son is adopted, sharing no genetic material with either parent. After amplifying the VNTR DNA from each member of the family, it is cut with a restriction enzyme and run on an agarose gel. Here are the results:

Uses of DNA Profiling  DNA profiling is used to solve crimes, test paternity, identification (immigration, unknown bacteria, virus)  In crime applications, the chances of two people having exactly the same DNA profile is 30,000 million to 1 (except for identical twins).

Who should the police arrest, suspect #1 or #2? Caution: DNA fingerprinting provides strong evidence that a suspect was at the crime scene. It does not prove the suspect committed the crime.