Control of Prokaryotic (Bacterial) Genes
Gene Control Many biotech techniques make use of existing mechanisms for controlling gene expression Gene expression = “gene activity,” the process by which information from a gene is used to synthesize a protein All genes are not being expressed at all times
Discussion Consider bacterial genes for metabolic enzymes… Under what circumstances would the prokaryote want those genes turned OFF? Why? Under what circumstances would the prokaryote want those genes turned ON? Why?
Remember Regulating Metabolism? Feedback inhibition product acts as an allosteric inhibitor of 1 st enzyme in tryptophan pathway but this is wasteful production of enzymes = inhibition - - Oh, I remember this from our Metabolism Unit!
Different way to Regulate Metabolism Gene regulation instead of blocking enzyme function, block transcription of genes for all enzymes in tryptophan pathway saves energy by not wasting it on unnecessary protein synthesis = inhibition - - -
Gene regulation in bacteria Cells vary amount of specific enzymes by regulating gene transcription turn genes on or turn genes off turn genes OFF example if bacterium has enough tryptophan then it doesn’t need to make enzymes used to build tryptophan turn genes ON example if bacterium encounters new sugar (energy source), like lactose, then it needs to start making enzymes used to digest lactose STOP GO
Gene Regulation Regulatory sequence: a sequence of DNA that interacts with regulatory proteins to control transcription of other genes Regulatory gene: DNA encoding a regulatory protein or RNA
Bacteria group genes together Operon genes grouped together with related functions, controlled by a single regulatory sequence example: all enzymes in a metabolic pathway promoter = RNA polymerase binding site single promoter controls transcription of all genes in operon transcribed as one unit & a single mRNA is made operator = DNA binding site of repressor protein structural genes = genes to be expressed
So how can these genes be turned off? Repressor protein binds to DNA at operator site blocking RNA polymerase blocks transcription Effector molecule Binds to repressor, changes its affinity for DNA binding site
operatorpromoter Operon model DNATATA RNA polymerase repressor = repressor protein Operon: operator, promoter & genes they control serve as a model for gene regulation gene1gene2gene3gene4 RNA polymerase Repressor protein turns off gene by blocking RNA polymerase binding site mRNA enzyme1enzyme2enzyme3enzyme4
mRNA enzyme1enzyme2enzyme3enzyme4 operatorpromoter Trp operon DNATATA RNA polymerase tryptophan repressor repressor protein repressor tryptophan – repressor protein complex Synthesis pathway model When excess tryptophan is present, it binds to trp repressor protein & triggers repressor to bind to DNA repressor without trp effector, inactive. With trp, active. blocks (represses) transcription gene1gene2gene3gene4 conformational change in repressor protein! 1234 repressor trp RNA polymerase trp
Tryptophan operon What happens when tryptophan is present? Don’t need to make tryptophan-building enzymes Tryptophan is allosteric regulator of repressor protein
mRNA enzyme1enzyme2enzyme3enzyme4 operatorpromoter Lac operon DNATATA RNA polymerase repressor repressor protein repressor lactose – repressor protein complex lactose lac repressor gene1gene2gene3gene4 Digestive pathway model When lactose is present, binds to lac repressor protein & triggers repressor to release DNA repressor without lac effector, active. With lac, inactive. induces transcription RNA polymerase 1234 lac conformational change in repressor protein! lac
Lactose operon (notice, the lacI gene for the repressor protein precedes the promoter, handy!) But wait! What if there’s lactose AND glucose present? Glucose is a much better energy source… do we still want to bother breaking down lactose?
Lactose operon Lac promoter has TWO binding sites One for RNA polymerase Lac repressor protein can bind to operator and inhibit that One for CAP, catabolite activating protein, before the promoter. RNA polymerase doesn’t bind well to this gene without CAP there.
Lactose operon As glucose concentration increases in a cell, the concentration of cAMP, or cyclic AMP, decreases (+glucose=-cAMP) When cAMP binds to CAP, it has the correct conformation to bind to DNA So, when glucose is low, the cAMP-CAP complex is bound to DNA, and RNA polymerase can attach When glucose is high, cAMP doesn’t bind to CAP, CAP doesn’t bind to DNA, and neither does RNA polymerase
Lactose operon In order for the structural genes to be transcribed, the cAMP-CAP complex must be bound to the CAP binding site, AND the repressor protein must not be bound to the operator
Operon Regulation Operons can be regulated by positive or negative means… Positive control: Regulatory proteins bind to DNA and stimulate expression. Negative control: Regulatory proteins bind to DNA to inhibit expression. …and can be inducible or repressible. Inducible: “Off by default.” The effector (inducer) interacts with regulatory proteins or DNA and turns expression on. Repressible: “On by default.” The effector (repressor) interacts with regulatory proteins or DNA turns expression off.
Discussion The lac operon is termed negative inducible. Why? The trp operon is termed negative repressible. Why?
Discussion Example: In a positive repressible operon, activator proteins are normally bound to the DNA and actually provide a binding site for RNA Polymerase. It’s therefore positive: the controlling protein stimulates expression. An inhibitor can bind to the activator protein, change its conformation, and prevent it from binding to RNA polymerase. It’s therefore repressible: it’s normally on, and the molecule turned gene expression off. That’s positive repressible. How might a positive inducible operon work?
Operon function Repressible operon usually functions in anabolic pathways synthesizing end products when end product is present in excess, cell allocates resources to other uses Inducible operon usually functions in catabolic pathways, digesting nutrients to simpler molecules produce enzymes only when nutrient is available cell avoids making proteins that have nothing to do, cell allocates resources to other uses And some genes are continuously expressed (always turned on). e.g. the genes that code for ribosomal complexes
Discussion Before we leave operons behind (for the moment), look at their big picture. Knowing what attaches where is not the most important part, it’s only a prerequisite to this: WHY does the trp operon function as it does? How is it advantageous? What is its adaptive significance? WHY does the lac operon function as it does? How is it advantageous? What is its adaptive significance?
Control of Eukaryotic Genes
Eukaryotic Control The control of gene expression in eukaryotes is complex! Involves regulatory genes, regulatory proteins, transcription factors, and more! Can occur at any step in the pathway from gene to functional protein: 1.packing/unpacking DNA 2.transcription 3.mRNA processing 4.mRNA transport 5.translation 6.protein processing 7.protein degradation
How do you fit all that DNA into nucleus? DNA coiling & folding double helix nucleosomes chromatin fiber looped domains chromosome from DNA double helix to condensed chromosome 1. DNA packing
Nucleosomes “Beads on a string” 1 st level of DNA packing histone proteins 8 protein molecules positively charged amino acids bind tightly to negatively charged DNA DNA packing movie 8 histone molecules
DNA packing as gene control Degree of packing of DNA regulates transcription tightly wrapped around histones no transcription genes turned off heterochromatin darker DNA (H) = tightly packed euchromatin lighter DNA (E) = loosely packed H E
DNA methylation Methylation of DNA blocks transcription factors no transcription genes turned off attachment of methyl groups (–CH 3 ) to cytosine C = cytosine nearly permanent inactivation of genes ex. inactivated mammalian X chromosome = Barr body
Histone acetylation Acetylation of histones unwinds DNA loosely wrapped around histones enables transcription genes turned on attachment of acetyl groups (–COCH 3 ) to histones conformational change in histone proteins transcription factors have easier access to genes
2. Transcription initiation transcription factors = proteins that bind to DNA to regulate transcription Some are activators, increase expression Others are repressors, decrease expression Actual rate of expression Depends on combination of transcription factors
2. Transcription initiation Example control regions on DNA Promoter sequence nearby control sequence on DNA binding of RNA polymerase & transcription factors “base” rate of transcription Enhancer sequence distant control sequences on DNA binding of activator proteins “enhanced” rate (high level) of transcription
Transcription complex Enhancer Activator Coactivator RNA polymerase II A B F E H TFIID Core promoter and initiation complex Activator Proteins regulatory proteins bind to DNA at distant enhancer sites increase the rate of transcription Coding region T A Enhancer Sites regulatory sites on DNA distant from gene Initiation Complex at Promoter Site binding site of RNA polymerase
Discussion That’s how an activator binds to a promoter or enhancer to increase expression… How could it work that I could attach a repressor or “silencer” protein to those same sequences to decrease expression?
3. Post-transcriptional control Alternative RNA splicing variable processing of exons creates a family of proteins
RNA interference Small interfering RNAs (siRNA) short segments of RNA (21-28 bases) bind to mRNA create sections of double-stranded mRNA “death” tag for mRNA triggers degradation of mRNA cause gene “silencing” post-transcriptional control turns off gene = no protein produced NEW! siRNA
Action of siRNA siRNA double-stranded miRNA + siRNA mRNA degraded functionally turns gene off Hot…Hot new topic in biology mRNA for translation breakdown enzyme (RISC) dicer enzyme
5. Control of translation Block initiation of translation stage regulatory proteins attach to 5' end of mRNA prevent attachment of ribosomal subunits & initiator tRNA block translation of mRNA to protein
6-7. Protein processing & degradation Protein processing folding, cleaving, adding sugar groups, targeting for transport Protein degradation
initiation of transcription 1 mRNA splicing 2 mRNA protection 3 initiation of translation 6 mRNA processing 5 Of turning genotypic diversity into even greater phenotypic diversity! 7 protein processing & degradation 4 4 Many methods
Discussion Work together with someone else, get a blank piece of paper, and: Summarize the most important take- home message or messages about control of gene expression... using only pictures and no text. (They don’t have to be pictures of DNA/RNA/etc itself!)
AP Biology Biotechnology
AP Biology A Brave New World
AP Biology TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG ACTAGCTGACTCGACTAGCATGATCGATCAGC TACATGCTAGCACACYCGTACATCGATCCTGA CATCGACCTGCTCGTACATGCTACTAGCTACTG ACTCATGATCCAGATCACTGAAACCCTAGATC GGGTACCTATTACAGTACGATCATCCGATCAGA TCATGCTAGTACATCGATCGATACTGCTACTGA TCTAGCTCAATCAAACTCTTTTTGCATCATGAT ACTAGACTAGCTGACTGATCATGACTCTGATCC CGTAGATCGGGTACCTATTACAGTACGATCATC CGATCAGATCATGCTAGTACATCGATCGATACT GCTACTGATCTAGCTCAATCAAACTCTTTTTGC ATCATGATACTAGACTAGCTGACTGATCATGAC TCTGATCCCGTAGATCGGGTACCTATTACAGTA CGATCATCCGATCAGATCATGCTAGTACATCGA TCGATACT human genome 3.2 billion bases
AP Biology Biotechnology today Genetic Engineering manipulation of DNA if you are going to engineer DNA & genes & organisms, then you need a set of tools to work with this unit is a survey of those tools… Our tool kit…
AP Biology Bacteria Bacteria review one-celled prokaryotes reproduce by mitosis binary fission rapid growth generation every ~20 minutes 10 8 (100 million) colony overnight! dominant form of life on Earth incredibly diverse
AP Biology Bacterial genome Single circular chromosome haploid naked DNA no histone proteins ~4 million base pairs ~4300 genes 1/1000 DNA in eukaryote How have these little guys gotten to be so diverse??
AP Biology Genetic Diversity Living things, eukaryotes and prokaryotes, have a variety of ways of mixing up genetic information “horizontally” Transduction: Viral transmission of genetic material Transposition: Movement of DNA segments within and between DNA molecules And prokaryotes have unique methods Conjugation: Cell-to-cell transfer of genetic material And…
AP Biology Transformation Bacteria are opportunists pick up naked foreign DNA wherever it may be hanging out have surface transport proteins that are specialized for the uptake of naked DNA import bits of chromosomes from other bacteria incorporate the DNA bits into their own chromosome express new genes transformation form of recombination mix heat-killed pathogenic & non-pathogenic bacteria mice die
AP Biology Plasmids Small supplemental circles of DNA ,000 base pairs self-replicating carry extra genes 2-30 genes genes for antibiotic resistance can be exchanged between bacteria Conjugation: “bacterial sex” rapid evolution can be imported from environment transformation
AP Biology How can plasmids help us? A way to get genes into bacteria easily insert new gene into plasmid = vector insert plasmid into bacteria bacteria now expresses new gene bacteria make new protein + transformed bacteria gene from other organism plasmid cut DNA recombinant plasmid vector glue DNA
AP Biology Biotechnology Plasmids used to insert new genes into bacteria gene we want cut DNA cut plasmid DNA insert “gene we want” into plasmid... “glue” together ligase like what? …insulin …HGH …lactase recombinant plasmid
AP Biology How do we cut DNA? Restriction enzymes restriction endonucleases evolved in bacteria to cut up foreign DNA “restrict” the action of the attacking organism protection against viruses & other bacteria bacteria protect their own DNA by methylation & by not using the base sequences recognized by the enzymes in their own DNA
AP Biology How do restriction enzymes work? Take a normal piece of paper. Tear/cut it into 3 long segments (tear from top to bottom) On each segment, write a random stream of DNA bases and their complementary base pairs. When you’re done, help me lay them all out end to end and tape them together so we have a nice long chromosome to demonstrate this with!
AP Biology What do you notice about these phrases? radar racecar Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? go hang a salami I’m a lasagna hog palindromes
AP Biology Restriction enzymes Action of enzyme cut DNA at specific sequences restriction site symmetrical “palindrome” produces protruding ends sticky ends will bind to any complementary DNA Many different enzymes named after organism they are found in EcoRI (GAATTC, E. coli), HindIII (AAGCTT, Hemophilus influenzae), BamHI (GGATCC, Bacillus amyloli)… Madam I’m Adam CTGAATTCCG GACTTAAGGC CTG|AATTCCG GACTTAA|GGC
AP Biology Restriction enzymes Cut DNA at specific sites leave “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA GTAACGAATTCACGC TT CATTGCTTAAGTGCG AA restriction enzyme cut site
AP Biology Sticky ends Cut other DNA with same enzymes leave “sticky ends” on both can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA
AP Biology Sticky ends help glue genes together TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCA CGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGT GCGAA gene you wantcut sites AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA chromosome want to add gene tocut sites AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene sticky ends chromosome with new gene added TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACG ATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATG CTAGC sticky ends stick together DNA ligase joins the strands Recombinant DNA molecule
AP Biology Demo Suppose we add this sequence: …o a solution containing these enzymes (whose restriction sites are): EcoRI (5’ G|AATTC 3’) HindIII (5’ A|AGCTT 3’) BamHI (5’ G|GATCC 3’) How many pieces of DNA would I have? 5’ ATCGGTTAAGCTTGGGCAACGGATCCGAGATCATCGT 3’
AP Biology Why mix genes together? TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACG ATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATG CTAGC Gene produces same protein in different organism or different individual aa “new” protein from organism ex: human insulin from bacteria human insulin gene in bacteria bacteriahuman insulin How can bacteria read human DNA?
AP Biology The code is universal Since all living organisms… use the same DNA use the same code book read their genes the same way
AP Biology Copy (& Read) DNA Transformation insert recombinant plasmid into bacteria grow recombinant bacteria in agar cultures bacteria make lots of copies of plasmid “cloning” the plasmid production of many copies of inserted gene! production of “new” protein transformed phenotype DNA RNA protein trait
AP Biology Grow bacteria…make more grow bacteria harvest (purify) protein transformed bacteria plasmid gene from other organism + recombinant plasmid vector
AP Biology Discussion But suppose I want to move a gene from a bacterium into a multicellular eukaryote… I can inject a plasmid directly, but that’s tedious and not highly effective Think back to the last unit… how could VIRUSES be used to accomplish this purpose?
AP Biology Uses of genetic engineering Genetically modified organisms (GMO) enabling plants to produce new proteins Protect crops from insects: BT corn corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) Extend growing season: fishberries strawberries with an anti-freezing gene from flounder Improve quality of food: golden rice rice producing vitamin A improves nutritional value
AP Biology Green with envy?? Jelly fish “GFP” Transformed vertebrates
AP Biology Cut, Paste, Copy, Find… Word processing metaphor… cut restriction enzymes paste ligase copy plasmids bacterial transformation is there an easier way?? find ????