1 PROTEIN SYNTHESIS copyright cmassengale. DNA and Genes 2copyright cmassengale.

Slides:



Advertisements
Similar presentations
RNA AND PROTEIN SYNTHESIS
Advertisements

DNA was dicovered by Juhann Friedrich in And the first demonstration that DNA contain genetic information was made in 1944 by Avery, Macleod.
copyright cmassengale
Protein Synthesis Jessica Hawley.
History of DNA.
PROTEIN SYNTHESIS.
Review 1. Base Pairing Rule Watson and Crick showed that DNA is a double helixWatson and Crick showed that DNA is a double helix A (adenine) pairs with.
PROTEIN SYNTHESIS.
Nucleic Acids.
RNA.
Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.
Protein Synthesis Human Biology. DNA Deoxyribonucleic Acid Twisted ladder or double helix Nucleotides Composed of alternating sugar (Deoxyribose) and.
1 PROTEIN SYNTHESIS CHAPTER 10 section 4. 2 Starting with DNA DNA ‘s code must be copied and taken to the cytoplasmDNA ‘s code must be copied and taken.
Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.
copyright cmassengale
PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA.
1 PROTEIN SYNTHESIS. DNA and Genes 2 Genes & Proteins DNA contains genes, sequences of nucleotide bases These genes code for polypeptides (proteins)
1 PROTEIN SYNTHESIS copyright cmassengale. 2 Protein Synthesis DNA ‘s code must be copied and taken to the ribosomes.DNA ‘s code must be copied and taken.
Hooray! First, a Video!. 2 Nucleic Acids 3 DNA!  Frederick Griffith in 1928 showed the DNA was the cell’s genetic material  Watson & Crick in the 1950’s.
12/15/14 Starter: How is the genetic code used to build proteins? Practice: Watch video and write five things you learn.
DNA and RNA.
PROTEIN SYNTHESIS.
RNA and Protein Synthesis. Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by copying part of.
RNA AND PROTEIN SYNTHESIS
1 DNA, RNA, and PROTEIN SYNTHESIS. 2 Transcription Translation DNA mRNA Ribosome Protein Prokaryotic Cell DNA  RNA  Protein.
1 PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for proteins Proteins are used to build cells.
1 DNA  RNA  Protein DNA  mRNA  Protein Nuclear membrane Transcription Translation DNA mRNA Ribosome Protein Eukaryotic Cell.
PROTEIN SYNTHESIS 1. DNA AND GENES DNA ■ DNA contains genes, sequences of nucleotide bases ■ Genes have different alleles. ■ These genes code for polypeptides.
DNA Structure & Replication DNA DNA.DNA is often called the blueprint of life. In simple terms, DNA contains the instructions for making proteins.
copyright cmassengale
Protein Synthesis: Making Those Proteins!. Review: DNA Hershey and Chase’s experiment showed that DNA was the genetic material.
copyright cmassengale
1 PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.
Jessica Hawley PROTEIN SYNTHESIS.  Identify and compare DNA and RNA.  Explain the three types of RNA.  Demonstrate understanding using codon and anticodon.
PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.
Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.
1 The Central Dogma of Biology PROTEIN SYNTHESIS.
PROTEIN SYNTHESIS copyright cmassengale1. Starting with DNA DNA is the molecule that stores genetic information in the nucleus.DNA is the molecule that.
PROTEIN SYNTHESIS. Review: DNA contains genes or a set of instructions. These genes code for a certain sequence of amino acids, that form polypeptides,
1. Transcription and Translation 2copyright cmassengale.
1 Nucleic Acids 2 Structure of DNA  made of monomers called nucleotides  nucleotides composed of a phosphate, deoxyribose sugar, and a nitrogen-containing.
RNA AND PROTEIN SYNTHESIS. Central Dogma of Biology! Genes are codes for making polypeptides (proteins) The nitrogenous bases (ATCG’s) contain the code!
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA.
1 PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.
RNA AND PROTEIN SYNTHESIS. How your cell makes very important proteins proteinsThe production (synthesis) of proteins. 2 phases2 phases: 1.Transcription.
1copyright cmassengale. RNA 2 3 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan copyright cmassengale.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA.
copyright cmassengale
Protein Synthesis Human Biology.
PROTEIN SYNTHESIS CHAPTER 10 section 4
How to Make a Protein?.
PROTEIN SYNTHESIS.
RNA AND PROTEIN SYNTHESIS
PROTEIN SYNTHESIS.
RNA AND PROTEIN SYNTHESIS
PROTEIN SYNTHESIS.
PROTEIN SYNTHESIS.
copyright cmassengale
copyright cmassengale
Title of notes: Transcription and Translation p. 16 & 17
13.1: RNA & Transcription.
Protein Synthesis Making Proteins
copyright cmassengale
Bell work – 3 minutes Pick a science word and write the definition.
PROTEIN SYNTHESIS.
Presentation transcript:

1 PROTEIN SYNTHESIS copyright cmassengale

DNA and Genes 2copyright cmassengale

DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells 3copyright cmassengale

4 Genes & Proteins  Proteins are made of amino acids linked together by peptide bonds  20 different amino acids exist copyright cmassengale

5 DNA Begins the Process DNA is found inside the nucleus Proteins, however, are made in the cytoplasm of cells by organelles called ribosomes Ribosomes may be free in the cytosol or attached to the surface of rough ER copyright cmassengale

6 Starting with DNA DNA ‘s code must be copied and taken to the cytosolDNA ‘s code must be copied and taken to the cytosol In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins)In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins) This process is called PROTEIN SYNTHESISThis process is called PROTEIN SYNTHESIS copyright cmassengale

RNA 7

8 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan copyright cmassengale

9 RNA Differs from DNA RNA has a sugar riboseRNA has a sugar ribose DNA has a sugar deoxyribose copyright cmassengale

10 Other Differences RNA contains the base uracil (U)RNA contains the base uracil (U) DNA has thymine (T) RNA molecule is single-strandedRNA molecule is single-stranded DNA is double- stranded DNA copyright cmassengale

11. Three Types of RNA Messenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomesMessenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomes Ribosomal RNA (rRNA), along with protein, makes up the ribosomesRibosomal RNA (rRNA), along with protein, makes up the ribosomes Transfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesizedTransfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesized copyright cmassengale

12 Messenger RNA Long Straight chain of Nucleotides Made in the Nucleus Copies DNA & leaves through nuclear pores Contains the Nitrogen Bases A, G, C, U ( no T ) copyright cmassengale

13 Messenger RNA (mRNA) Carries the information for a specific proteinCarries the information for a specific protein Made up of 500 to 1000 nucleotides longMade up of 500 to 1000 nucleotides long Sequence of 3 bases called codonSequence of 3 bases called codon AUG – methionine or start codonAUG – methionine or start codon UAA, UAG, or UGA – stop codonsUAA, UAG, or UGA – stop codons copyright cmassengale

14 Ribosomal RNA (rRNA) rRNA is a single strand 100 to 3000 nucleotides longrRNA is a single strand 100 to 3000 nucleotides long Globular in shapeGlobular in shape Made inside the nucleus of a cellMade inside the nucleus of a cell Associates with proteins to form ribosomesAssociates with proteins to form ribosomes Site of protein SynthesisSite of protein Synthesis copyright cmassengale

15 The Genetic Code A codon designates an amino acid An amino acid may have more than one codon There are 20 amino acids, but 64 possible codons Some codons tell the ribosome to stop translating copyright cmassengale

16 The Genetic Code Use the code by reading from the center to the outside Example: AUG codes for Methionine copyright cmassengale

17 Remember the Complementary Bases On DNA: A-T C-G On RNA: A-U C-G copyright cmassengale

18 Transfer RNA (tRNA) Clover-leaf shape Single stranded molecule with attachment site at one end for an amino acid Opposite end has three nucleotide bases called the anticodon copyright cmassengale

19 Codons and Anticodons The 3 bases of an anticodon are complementary to the 3 bases of a codon Example: Codon ACU Anticodon UGA UGA ACU copyright cmassengale

Transcription and Translation 20copyright cmassengale

21 Pathway to Making a Protein DNAmRNA tRNA (ribosomes) Protein copyright cmassengale

22 Protein Synthesis   The production or synthesis of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA must be processed before it leaves the nucleus of eukaryotic cells copyright cmassengale

23 Transcription The process of copying the sequence of one strand of DNA, the template strand mRNA copies the template strand Requires the enzyme RNA Polymerase copyright cmassengale

24 Question:  What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’ copyright cmassengale

25 Answer: DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’RNA 3’-CGCAUAC-5’ copyright cmassengale

26 Transcription During transcription, RNA polymerase binds to DNA and separates the DNA strands RNA Polymerase then uses one strand of DNA as a template to assemble nucleotides into RNA copyright cmassengale

27 Transcription Promoters are regions on DNA that show where RNA Polymerase must bind to begin the Transcription of RNA Called the TATA box Specific base sequences act as signals to stop Called the termination signal copyright cmassengale

28 mRNA Processing After the DNA is transcribed into RNA, editing must be done to the nucleotide chain to make the RNA functional Introns, non-functional segments of DNA are snipped out of the chain copyright cmassengale

29 mRNA Editing Exons, segments of DNA that code for proteins, are then rejoined by the enzyme ligase A guanine triphosphate cap is added to the 5” end of the newly copied mRNA A poly A tail is added to the 3’ end of the RNA The newly processed mRNA can then leave the nucleus copyright cmassengale

30 mRNA Transcript mRNA leaves the nucleus through its pores and goes to the ribosomes copyright cmassengale

31 Translation Translation is the process of decoding the mRNA into a polypeptide chain Ribosomes read mRNA three bases or 1 codon at a time and construct the proteins copyright cmassengale

32 Transcription Translation copyright cmassengale

33 Ribosomes Made of a large and small subunit Composed of rRNA (40%) and proteins (60%) Have two sites for tRNA attachment --- P and A copyright cmassengale

34 Step 1- Initiation mRNA transcript start codon AUG attaches to the small ribosomal subunit Small subunit attaches to large ribosomal subunit mRNA transcript copyright cmassengale

35 Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG copyright cmassengale

Step 2 - Elongation As ribosome moves, two tRNA with their amino acids move into site A and P of the ribosome Peptide bonds join the amino acids 36copyright cmassengale

37 Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon copyright cmassengale

38 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation copyright cmassengale

39 mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves) copyright cmassengale

40 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU copyright cmassengale

41 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon copyright cmassengale

42 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 copyright cmassengale

43 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon copyright cmassengale

44 mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination copyright cmassengale

45 End Product –The Protein! The end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199 copyright cmassengale

46 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1 copyright cmassengale

47copyright cmassengale