Definitions tran·scrip·tion (noun): the act of making an exact copy of a document. –Example: the very old method for making a copy of a book by hand. trans·la·tion (noun): the rendering of the meaning of something into a different language. –Example: translating Leo Tolstoy’s novel “War and Peace” from Russian (the original) into English.

Translation The synthesis of a protein polymer from a RNA template –The ribosome translates the chemical language of nucleic acids to amino acids –Provides a control point for regulation of gene expression –Amplification step (can make many protein copies)

Translation There must be a nucleic acid code for amino acid sequences –4 different nucleic acid bases, 20 different amino acids –PLUS, need information about where to START and where to STOP translating –Possible CODON sizes: 1 base4 1 = 4not big enough 2 bases4 2 = 16not big enough 3 bases4 3 = 64THIS WOULD WORK The code could be overlapping or NONOVERLAPPING Nonoverlapping is less sensitive to mutation

Translation Codons are nonoverlapping 3 nucleotide units –START= AUG (Methionine) –STOP= UGA, UAG, UAA (does NOT also encode an amino acid) –61 of 64 codons are left for amino acids There are only 20 amino acids The code is “degenerate” with several codons per amino acid –CUN = Leucine –UCN = Serine –CCN = Proline –ACN = Threonine (ACA, ACG, ACC, ACU) (Where N = A, G, C or U) **Note, much of the degeneracy is in the 3rd position of the codon**

Reading the codon table

Transcribe & Translate Txn factor RNAp Co- factor 5’-…TGAGTCACTGTACGCTATATAAGGC…GATCGCCTCAGGAACCACCATGCT…-3’ 3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’ 5’-…TATATAAGGC…GATCGCCTCAGGAACCACCATGCTAGCTTGCTGAAATAAA…-3’ 3’-…ATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGATCGAACGACTTTATTT…-5’ 5’-GCCUCAGGAACCACC AUG CUA GCU UGC UGA…AAUAAA…AAAAAAAAAA-3’ TXN TLN: M L A C *(stop) 5’-GCUAAAGAUAGUUAAAUGACAGACUCAGACCCAUAAAAUAAA…AAAAAAAAAA-3’ TLN:

Transfer RNAs (tRNA) Bridge between nucleic acid and amino acid languages – nts long –Several modified bases (e.g. pseudouridine, etc) –Complementary regions base pair to form cloverleaf-like structure Packs further to look like:  Amino acid attached to 3’-OH via ester linkage Anticodon loop basepairs with mRNA codon

Transfer RNAs (tRNA) Degeneracy of code –Lots of tRNA genes –1 tRNA can recognize > 1 codon Strict base pair rules for codon position 1 and 2 “wobble” in position 3 –Non Watson-Crick pairing e.g. G = U pairing

Transfer RNAs (tRNA) Examples of tRNAs tolerating G = U pairs in codon position 3

Charging tRNAs The accuracy for protein synthesis is mainly found in the accuracy of attaching the correct amino acid to the correct tRNA –20 Aminoacyl tRNA synthetase enzymes –1 enzyme for each amino acid –1 enzyme can recognize >1 tRNA Specificity from interactions with acceptor and anticodon arms of tRNA 2 step reaction ATP + AA --> AA-AMP + PPi AA-AMP + tRNA --> AA-tRNA + AMP tRNA synthetase enzymes proofread: Can hydrolyze wrong amino acid from tRNA

Charging tRNAs 2 step reaction ATP + AA --> AA-AMP + PPi AA-AMP + tRNA --> AA-tRNA + AMP tRNA synthetase enzymes proofread: Can hydrolyze wrong amino acid from tRNA

The ribosome Large RNA-Protein complex Large ribosomal subunit (60S) Small ribosomal subunit (40S) Steps in translation INITIATION –Bind mRNA, find start ELONGATION –Find next amino acid, add it TERMINATION –Recognize stop, and release

Translation mechanism: bacteria INITIATION –Small subunit binds “Shine-Dalgarno” sequence in mRNA 5’-AGGAGG-3’ DNA: 5’-…TATAAT n n n n A n n n n AGGAGG n n n n n ATG…-3’ mRNA: 5’-A n n n n AGGAGG n n n n n AUG…-3’

Translation mechanism: bacteria INITIATION –Small subunit binds Shine-Dalgarno sequence in mRNA to locate AUG –INITIATION FACTORS IF1, IF2, IF3 IF2 binds GTP

Translation mechanism: bacteria INITIATION –Small subunit binds Shine-Dalgarno sequence in mRNA to locate AUG –INITIATION FACTORS IF1, IF2, IF3 IF2 binds GTP IF2 binds initiating tRNA-Met

Translation mechanism: bacteria INITIATION –Small subunit binds Shine-Dalgarno sequence in mRNA to locate AUG –INITIATION FACTORS IF1, IF2, IF3 IF2 binds GTP IF2 binds initiating Met-tRNA Recruit large subunit, release IF1, IF3 If codon-anticodon interaction is correct, IF2 hydrolyzes GTP and leaves

Translation mechanism: eukaryotes INITIATION –SCANS 5’ --> 3’ for Start –eIF4 and other factors involved in sensing additional features of mRNA 5’-CAP structure 3’-end polyA tail –eIF1, 2, 3 + Small subunit complex binds 5’-CAP region –Scan 5’--> 3’ for a different consensus sequence 5’-CCACCAUG-3’

Translation mechanism: bacteria ELONGATION –After large subunit bound, 3 sites are present in ribosome Aminoacyl (A) site Peptidyl (P) site Exit (E) site –tRNA-MET in P site –EF-Tu + GTP + Phe-tRNA bind in A site –If codon-anticodon interaction is proper, hydrolyze GTP --> GDP, release EF-Tu

Translation mechanism: bacteria ELONGATION –If codon-anticodon interaction is proper, hydrolyze GTP --> GDP, release EF-Tu –Peptidyl transferase enzyme catalyzes bond formation Ribozyme (large subunit RNA) –Met is now attached at the “A” site: Met-Phe-tRNA

Translation mechanism: bacteria ELONGATION –Whole ribosome must be translocated 3 nts downstream on mRNA –EF-G hydrolyzes GTP for translocation reaction –tRNA in P site is now in E –Met-Phe-tRNA is now in P –Repeat ELONGATION cycle until a stop codon is reached

Translation mechanism: bacteria ELONGATION –Repeat ELONGATION cycle until a stop codon is reached –EF-Tu + GTP + Ser-tRNA --> EF-Tu + GDP (note exit of tRNA from E site) –Peptidyl transferase activity would yield Met-Phe-Ser-tRNA in A site –And so on…

Translation mechanism: bacteria TERMINATION –Stop codons are not recognized by any wildtype tRNAs –Three Release Factor proteins RF1 RF2 RF3 –Enter A site and trigger hydrolysis of Met-Phe-Ser from tRNA –Large and small subunits dissociate from mRNA template U A A

Polyribosomes mRNAs can be translated by multiple ribosomes at same time Amplification step in gene expression

Coupled TXN & TLN: bacteria A gene can be transcribed and translation of it can start before TXN is finished Could this happen in eukaryotes?

Frameshift mutations Consider the following mRNA sequence Frameshift mutations insert or delete one or more bases into an Open Reading Frame (ORF) –Insert one base –Delete one base 5’-GCCUCAGGAACCACC AUG CUA GCU UGC UGAAAUAAAAAAAAAAA-3’ TLN: M L A C *(stop) 5’-GCCUCAGGAACCACC AUG CUC AGC UUG CUG AAA UAA AAAAAAAAA-3’ TLN: M L S L L K *(stop) 5’-GCCUCAGGAACCACC AUG UAG CUUGCUGAAAUAAAAAAAAAAA-3’ TLN: M *(stop)

Nonsense mutations & nonsense mediated decay Consider the following mRNA sequence Nonsense mutations change an amino acid codon to a stop codon If this mutation is in any exon other than the last one, Nonsense mediated decay (NMD) will block translation of it 5’-GCCUCAGGAACCACC AUG CUA UGG UGC UGAAAUAAAAAAAAAAA-3’ TLN: M L W C *(stop) 5’-GCCUCAGGAACCACC AUG CUA UGA UGC UGAAAUAAAAAAAAAAA-3’ TLN: M L *(stop)

Nonsense mutations & nonsense mediated decay Exon-Junction Complex (EJC) proteins are deposited on transcripts ~20 nts upstream of new Exon-Exon junctions Ribosome knocks them off during TLN If ribosome doesn’t knock them off, transcript is destroyed –Wildtype mRNA: –Nonsense mutation mRNA: –EJC that is not removed generates a signal targeting mRNA for destruction X EJC XX