Warm Up 1.Name as many of the types of inheritance you can remember from Friday. 2.What are the different blood types a person can have?

Agenda Objective: SWBAT: identify that DNA is made up of the nucleotides adenine, guanine, cytosine, and thymine –KWL Chart on DNA –DNA Building Activity –Notes on DNA You will not always get a stamp if you simply finished the warm up. I will start checking for correct answers. Testing

Quizzes If you did not take the quiz last week, you need to make it up in order to avoid earning a zero. If you earned below a C on the quiz, you can come in to do a retake.

KWL Chart

What do we already know about DNA? It stands for Deoxyribonucleic Acid All living things have DNA In Eukaryotic cells, DNA is found in the nucleus It carries our genetic information and determines our traits Segments of DNA are called genes DNA is bundled up into chromosomes

Why is DNA important? DNA contains our genetic information DNA is a set of instructions for making proteins Proteins determine just about everything about you –Whether you are lactose intolerant –What skin color you have –Your eye color –Control the rate of reactions in our body

DNA building activity

Warm up Directions: Unless I tell you otherwise, you do not have to copy the questions anymore But you need to date every warm up and try to answer the questions correctly. Name at least two reasons why DNA is important. Write in complete sentences.

Warm up 1.Write three observations about this picture. 2.Make an inference about what you think is happening.

Agenda Objectives: SWBAT Describe what happens during replication and use the base pairing rule to determine sequences of DNA. Notes Practice Problems Cracking the Code Video

What is the Structure of DNA? a.Deoxyribonucleic Acid or DNA looks like a twisted ladder or double helix b.It’s made up of subunits called nucleotides -Each nucleotide has a sugar, a phosphate and a nitrogen base

Label the parts on your copy: Phosphate Sugar (Deoxyribose) Nitrogen Base Hydrogen Bonds

Types of Nitrogen Bases a.There are 4 types of nitrogen bases in DNA -A= Adenine -T= Thymine -C= Cytosine -G= Guanine b.Nitrogen bases connect the 2 strands of DNA together, like the rungs (steps) of a ladder

Base Pairing a.Nitrogen bases pair up to make the steps of the ladder b.In DNA -“A” always pairs with “T” And -“C” always pairs with “G”

Complementary Strands a.Each strand of DNA is complimentary to the other –That means that each strand’s nitrogen bases match up (A - T, C - G) b.Example: If the code on one strand of DNA is ACGTC, then the complimentary strand would be TGCAG

Practice Problems: Write the Complimentary Strand in your notebook 1. ATCGC 2. TGCAGA 3. CCCGTACGTA 4. TAGTGACTAGC 5. AAAGTAATGTTCAGTACTTT

Before a cell divides, what does it need to do?

DNA Replication Video

Enzymes a.Enzymes are responsible for unzipping the DNA and adding the bases to form the 2 molecules of DNA. b.Enzymes are proteins in our cells. They help regulate chemical reactions in our body. c.Helicases are enzymes that split the DNA and DNA polymerase adds the bases d.Proteins help make proteins!

DNA- Cracking the Code code-of-life.htmlhttp:// code-of-life.html

Warm up 1.What happens during Replication? 2.If a strand of DNA is ATGATTTAGTACCC, what is the complimentary strand of DNA?

1.What’s different about these two structures? (Name at least two differences) 2.What happens during Replication? 3.If a strand of DNA is ATGATTTAGTAC CC, what is the complimentary strand of DNA?

What’s different about these two structures?

Agenda Objectives: SWBAT: compare and contrast DNA and RNA by creating a chart Test Taking Strategies Comparison Chart Video Clip Worksheet Cracking the Code video

RNA a.RNA is another type of nucleic acid that’s found in the nucleus and cytoplasm of a cell b.Unlike DNA, RNA is made up of only one strand of nucleotides

Difference in Nitrogen Bases a.Instead of having the base thymine, RNA has the base uracil b.That means when RNA is formed, adenine pairs with uracil (A - U)

Difference in Sugars a.One main difference between RNA and DNA is that they are made up of different sugars -RNA has the sugar ribose -DNA has the sugar deoxyribose

Different segments DNA is split up into segments called genes mRNA is split up into sections called codons. –Every three bases of mRNA = one codon. –Example: AUC or GGU –Codons code for amino acids that make up proteins

Draw the following chart DNARNA Ex. Type of sugar Has deoxyriboseHas ribose

How are proteins made? In order to make proteins, 3 processes must occur -DNA Replication -Molecule of DNA is copied -Transcription -Strand of mRNA is made using DNA as a template -Translation -mRNA codes for specific amino acids that make a protein

Worksheet

Warm Up

Agenda Objectives: SWBAT explain that replication, transcription and translation are codependent processes that ultimately make proteins. Notes Practice Worksheet White Board Practice??

Video

What happens during Transcription? A strand of messenger RNA (mRNA) is made using DNA as a template.

What happens during Transcription? One strand of the DNA is the template Nitrogen bases attach to the DNA by following the base pairing rule except U will replace T The sequence (order of the nitrogen bases) of RNA depends on the strand of DNA Example:A-C-C-A-A-A U-G-G-U-U-U

demo

DNA- Cracking the Code code-of-life.htmlhttp:// code-of-life.html

Practice Work Sheet

White Board Practice

What’s missing in this nucleotide? deoxyribose + phosphate + _________ ______

What type of sugar does RNA have?

“A” pairs with ____ “C” pairs with ____

(DNA or RNA)_________ is made up of 2 strands of nucleotides.

If the code of bases on one strand of DNA is AGCCTAGG, then what is the code on the complimentary strand?

What is the process that makes a copy of DNA?

In RNA, Thymine is replaced with ________

If a strand of DNA is ATGACCATGTAAA, what would be the complimentary mRNA strand?

What is made at the end of translation?

Is this a strand of DNA or RNA? –AGCCGUUAUGCGAU

Brain Pop Video ddevelopment/rna/ ddevelopment/rna/

Warm Up 1.In RNA, A pairs with _____ 2.In order to make a protein, three processes must occur: 1._________________ 2._________________ 3._________________ 3.In which of the three processes is a protein made?

Agenda Objectives: SWBAT explain that replication, transcription and translation are codependent processes that ultimately make proteins AND In transcription, a strand of mRNA is created from a strand of DNA with uracil replacing thymine. Video Practice Protein Synthesis DNA- Cracking the Code Video

Protein Synthesis Video

Transcription….DNA to mRNA The only difference is that mRNA has a U instead of a T. mRNA is only one strand of nucleotides, so we only need to use one strand of DNA as a template.

Practice Problems: Copy and answer the following problems in your notebook. 1. ATGGCA UACCGU 2. TGCAGATTA 3. CCAGTACGT 4. AAGTGGGTAGCA 5. ATAGTAATGAACAGTACCGTG

Practice Now split each of your answers into codons 1. ATGGCA UAC CGU What happens after transcription??

Translation Use a genetic code chart to find the amino acids 1. ATCGCA UAG CGU Tyr -- Arg

Practice Worksheets

DNA- Cracking the Code code-of-life.htmlhttp:// code-of-life.html

Agenda Objectives: SWBAT explain that replication, transcription and translation are codependent processes that ultimately make proteins AND In transcription, a strand of mRNA is created from a strand of DNA with uracil replacing thymine. Spelling out Proteins Lab DNA- Cracking the Code Video

Spelling out Proteins Lab Directions: –Answer review questions at the top –Receive a strip of DNA from the teacher –Write down the strand of DNA –Transcribe the DNA into mRNA –Separate the mRNA into codons –Find each codon around the room –Flip the card up to find the word –Write each word down until you’ve completed your sentence –Check the sentence with Mrs. LA –Receive next strip of DNA The first 3 people who finish all 10 sentences correctly will receive extra credit!

DNA- Cracking the Code code-of-life.htmlhttp:// code-of-life.html