Table S4. Summary of proteins identified by MALDI-TOF-MS Spot no.* Average Ratio** NCBI accesion no. Gene nameProtein name Theoretical pI/MW SCORE Sequence.

Slides:

Advertisements

Similar presentations

Chapter 16 - The Citric Acid Cycle The citric acid cycle (tricarboxylic acid cycle, Kreb’s cycle) is amphibolic (both catabolic and anabolic) The cycle.

Advertisements

Chapter 14 - Electron Transport and Oxidative Phosphorylation The cheetah, whose capacity for aerobic metabolism makes it one of the fastest animals.

Overview of oxidative phosphorylation

Electron Transport Chain/Respiratory Chain Proton gradient formed Four large protein complexes Mitochondria localized Energetically favorable electron.

Lecture 27 Exam on Friday Up to glyoxalate cycle.

Overview of Citric Acid Cycle The citric acid cycle operates under aerobic conditions only The two-carbon acetyl group in acetyl CoA is oxidized to CO.

The construction of cells DNA or RNA Protein Carbohydrates Lipid etc.

The construction of cells DNA or RNA Protein Carbohydrates Lipid etc. 04.

Chapter 14 - Electron Transport and Oxidative Phosphorylation

ENZYME CLASSIFICATION EXERCISE (1) GLUCOSE + ATP  GLUCOSE-6-PHOSPHATE + ADP + H + (2) CH 3 CH 2 OH + NAD +  (CH3)CHO + NADH + H + (3) ATP + H 2 O  ADP.

OXIDATION PHOSPHORYLATION-1 BIOC DR. TISCHLER LECTURE 28.

Electron Carriers 24.3 Electron Transport Chapter 24 Metabolism and Energy Production.

Citric Acid Cycle. General Considerations What is the importance of citric acid cycle? final common pathway for oxidation of fuel molecules provides intermediates.

Recap of Fermentations Glucose -> 2 pyruvate + 2 ATP + 2 NADH 2 pyruvate + 2 NADH -> 2 lactate 2 pyruvate + 2 NADH -> 2 ethanol + 2 CO 2 First part of.

Final Review C483 Spring Replication.

1 Chapter 3: Protein ZHOU Yong Department of Biology Xinjiang Medical University.

Enzymes Enzymes as Biological Catalysts

Stages of Metabolism.

Last Lecture….. Proteins Carbohydrates Enzymes. Study Guide Use study guide to determine what you need to know. 95% of test will be from study guide.

Tricarboxylic Acid Cycle (TCA), Krebs Cycle Occurs totally in mitochondria Pyruvate (actually acetate) from glycolysis is degraded to CO 2 Some ATP is.

Aerobic Metabolism. Summary of Anaerobic Glycolysis Glucose + 2 ADP + 2 P i 2 Lactate + 2 ATP + 2 H 2 O + 2 H +

Oxidative phosphorylation Biochemistry, 4 th edition, RH Garrett & CM Grisham, Brooks/Cole (Cengage); Boston, MA: 2010 pp Instructor: Kirill Popov.

The Respiratory Chain & Oxidative Phosphorylation.

Chapter 19 Oxidative Phosphorylation and Photophosphorylation.

RNA. ________ are coded DNA instructions that control the ___________ of proteins. Genetic ______________ can be decoded by copying part of the ___________.

Metagenome Analysis: a case study Analysis of a thermophilic terephthalate-degrading syntrophic community Thanos Lykidis.

Properties of Enzymes. Enzymes are catalysts What properties would ideal catalysts have?

Chapter 13 - The Citric Acid Cycle The citric acid cycle is involved in the aerobic catabolism of carbohydrates, lipids and amino acids Intermediates of.

Cellular Respiration (Chapter 9). Energy source Autotrophs: Producers Plants, algae and some bacteria Make own organic molecules Heterotrophs: Consumers.

Electron transport chain Cellular respiration is a series of reactions that: -are oxidations – loss of electrons -are also dehydrogenations lost electrons.

Electron Transport Chain and Oxidative Phosphorylation Dr. Sooad Al-Daihan Biochemistry department.

OXIDATIVE PHOSPHORYLATION. Oxidative Phosphorylation  The process in which ATP is formed as a result of the transfer of electrons from NADH or FADH 2.

Clinical Presentation Curriculum A Guide to Intermediary Metabolism Jack Blazyk, Ph.D

The Electron-Transport Chain

Analogous to Succinate dehydrogenase. Analogous to fumarase.

MiRNAPredicted targetsPutative function of targets miRC1GRMZM2G029833_T01DNA binding / DNA-directed RNA polymerase miRC4 GRMZM2G171796_T01; GRMZM2G355906_T03;

Clinical Presentation Curriculum A Guide to Intermediary Metabolism Jack Blazyk, Ph.D

Mitochondrial Electron Transport The cheetah, whose capacity for aerobic metabolism makes it one of the fastest animals.

Fatty acid breakdown The oxidation of fatty acids

LEHNINGER PRINCIPLES OF BIOCHEMISTRY

Protein and cell nano-structures. Electron Carriers Function in Multienzyme Complexes The electron carriers of the respiratory chain are organized into.

Chapter 14 - Electron Transport and Oxidative Phosphorylation

More about proteins Proteins are the building block of our bodies. They make up many components (muscle, skin) or direct the synthesis of components (bone,

Classification and Nomenclature of Enzymes

SGPPname Crystals seen?ListEnzyme name PfAl007201WESYesWesthioredoxin PfAl006677WES WesCholine kinase PfAl008572WES Wescyclophilin-like PfAl004964WES WesProtein.

How Enzymes Work Pratt & Cornely Ch 6.

1 Number > Size Macromolecules (10 4 to10 6 ) Small molecules (10 2 to10 4 ) Structure Proteins (ribozymes) Most are heterocyclic organic compounds.

No.ClonePutative functionAccessionE -valueNo.ClonePutative function Accession number E valueNo.ClonePutative functionAccessionE -value Forward library.

CCAGTTGCCGCGTTCACCCTCTCCTCATCCGCGGTTCACCGGCCTCGTTGAGACTGCCTG  SCO0033 GGCCGTCATTCCGACAGCACCCACGTCTCACTCCCCGTGCCCATGCGGGGACCGGGCGGC CCGGCAGTAAGGCTGTCGTGGGTGCAGAGTGAGGGGCACGGGTACGCCCCTGGCCCGCCG.

Exacerbated oxidative stress in the fasting liver according to fuel partitioning Thierry Wasselin 1,2, Sandrine Zahn 1,3, Yvon Le Maho 1,3, Alain Van Dorsselaer.

Protein. Protein and Roles 1: biological process unknown 1.1 Structural categories 1.2 organism categories 1.3 cellular component o unlocalized.

Isoenzymes. Role of cofactors and coenzyme vitamins in the catalytic action of enzymes.

20.4 Regulation of Enzyme Activity

Chapter 7 Enzyme Mechanisms.

Enzymes Enzymes as Biological Catalysts

Oxidative Phosphorylation

Actn3 KO mice display a shift toward more oxidative pathways of metabolism Enzyme analyses show increased expression of enzymes involved in the glycolysis.

Requirements for oxidative phosphorylation

Gene Expression Continued

The making of proteins for …..

Chapter 23 Metabolism and Energy Production

Chapter Three: Enzymes

Pyruvate Oxidation and the Citric Acid Cycle

Metabolic functions of riboflavin

The acetyl-CoA synthase/carbon monoxide dehydrogenase (Acs) operon gene organization of unFirm_1 and comparisons with sequenced acetogen genomes (a) and.

Condensed metabolic map of M

Pyruvate Dehydrogenase

Categorization of the top 200 N

Presentation transcript:

Table S4. Summary of proteins identified by MALDI-TOF-MS Spot no.* Average Ratio** NCBI accesion no. Gene nameProtein name Theoretical pI/MW SCORE Sequence coverage*** Function**** YP_095533lpg1504pyruvate dehydrogenase E1 component oxidoreductase protein AceE6.09/ %enzyme YP_095533lpg1504pyruvate dehydrogenase E1 component oxidoreductase protein AceE6.09/ %enzyme 32.04YP_095776lpg1750ClpB protein5.49/ %chaperone 42.05YP_095776lpg1750ClpB protein5.49/ %chaperone 52.06YP_095776lpg1750ClpB protein5.49/ %chaperone 63.01YP_096719lpg2714threonyl tRNA synthase6.09/ %enzyme 63.01YP_096333lpg2324L-gulono-gamma-lactone oxidase5.99/ %enzyme 78.48YP_096333lpg2324L-gulono-gamma-lactone oxidase5.99/ %enzyme YP_096228lpg2216purine NTPase, putative6.24/ %enzyme 91.52YP_095398lpg1369chaperone Hsp90 HtpG5.46/ %chaperone 101.9YP_095408lpg1379urocanate hydratase6.48/ %enzyme YP_096964lpg2971malate dehydrogenase (NAD-linked), malic enzyme6.13/ %enzyme YP_096964lpg2971malate dehydrogenase (NAD-linked), malic enzyme6.13/ %enzyme YP_096263lpg2251succinate semialdehyde dehydrogenase5.63/ %enzyme YP_094292lpg0238glycine betaine aldehyde dehydrogenase6.02/ %enzyme YP_094527lpg0483hypothetical protein lpg / %unknown

Table S4. (continued) Spot no.* Average Ratio** NCBI accesion no. Gene nameProtein name Theoretical pI/MW SCORE Sequence coverage*** Function**** YP_094190lpg0136pyruvate kinase II5.82/ %enzyme YP_095750lpg1723inosine-5'-monophosphate dehydrogenase6.48/ %enzyme YP_094237lpg0183amine oxidase, flavin containing6.06/ %enzyme YP_095380lpg1351piperidine-6-carboxylate dehydrogenase6.21/ %enzyme YP_095380lpg1351piperidine-6-carboxylate dehydrogenase6.21/ %enzyme YP_095380lpg1351piperidine-6-carboxylate dehydrogenase6.21/ %enzyme YP_094183lpg0129methylmalonate-semialdehyde dehydrogenase6.26/ %enzyme YP_094844lpg0809succinyl-diaminopimelate desuccinylase5.57/ %enzyme YP_095788lpg1762sigma 54-dependent response regulator6.31/ %transcription regulater YP_094670lpg0634hypothetical protein lpg / %unknown YP_094670lpg0634hypothetical protein lpg / %unknown YP_095626lpg1597thiolase (acetyl-CoA acetyltransferase )6.72/ %enzyme YP_095020lpg0987membrane protein, Tfp pilus assembly, pilus retraction ATPase PilT6.62/ %motility YP_095851lpg1825acyl CoA C-acetyltransferase6.46/ %enzyme YP_095851lpg1825acyl CoA C-acetyltransferase6.46/ %enzyme YP_094967lpg09333-dehydroquinate synthetase6.5/ %enzyme

Table S4. (continued) Spot no.* Average Ratio** NCBI accesion no. Gene nameProtein name Theoretical pI/MW SCORE Sequence coverage*** Function**** YP_095382lpg13533-ketoacyl CoA thiolase (acetyl-CoA acetyltransferase )6.47/ %enzyme YP_095382lpg13533-ketoacyl CoA thiolase (acetyl-CoA acetyltransferase )6.47/ %enzyme YP_094526lpg0482endo-1,4 beta-glucanase6.73/ %enzyme YP_096290lpg22784-hydroxyphenylpyruvate dioxygenase5.97/ %enzyme YP_094905lpg08703-hydroxyisobutyryl Coenzyme A hydrolase5.66/ %enzyme YP_094434lpg0390hypothetical protein lpg / %unknown YP_095733lpg1706arginine/ornithine succinyltransferase7.05/ %enzyme YP_096262lpg2250alcohol dehydrogenase, iron containing5.78/ %enzyme YP_095945lpg1928 indigoidine synthase A-like protein, uncharacterized enzyme involved in pigment biosynthesis 5.79/ %Toxin production YP_096220lpg2208zinc binding dehydrogenase6.5/ %enzyme YP_096220lpg2208zinc binding dehydrogenase6.5/ %enzyme YP_095906lpg1889lipase6.33/ %enzyme YP_095785lpg1759flagellar motor switch protein FliG4.97/ %motility YP_094982lpg09482-oxoglutarate ferredoxin oxidoreductase beta subunit8.39/ %enzyme 436.1YP_095906lpg1889 lipase6.33/ %enzyme

Table S4. (continued) Spot no.* Average Ratio** NCBI accesion no. Gene nameProtein name Theoretical pI/MW SCORE Sequence coverage*** Function**** YP_096944lpg2951cystathionine beta synthase5.76/ %enzyme YP_094875lpg0840polysialic acid capsule expression protein6.2/ %enzyme YP_096868lpg2874hypothetical protein lpg / %unknown YP_096868lpg2874hypothetical protein lpg / %unknown YP_095856lpg1830hydroxymethylglutaryl-CoA lyase5.7/ %enzyme YP_096618lpg2613UDP-N-acetylenolpyruvoylglucosamine reductase6.46/ %enzyme YP_095445lpg1416purine nucleoside phosphorylase II5.7/ %enzyme YP_095154lpg1121hypothetical protein lpg / %unknown YP_095751lpg1724septum site-determining protein MinD5.78/ %motility YP_094561lpg0517aldo/keto reductases, related to diketogulonate reductase6.35/ %enzyme 547.5YP_096683lpg2678Hypothetical protein lpg / %unknown YP_094708lpg0672acetoacetate decarboxylase ADC5.43/ %enzyme YP_095025lpg0992hypothetical protein lpg / %unknown YP_096690lpg2685dienelactone hydrolase family protein6.38/ %enzyme YP_094574lpg0531 succinate dehydrogenase iron-sulfur protein subunit B (succinate dehydrogenase catalytic subunit) 6.18/ %enzyme

Table S4. (continued) Spot no.* Average Ratio** NCBI accesion no. Gene name Protein name Theoretical pI/MW SCORE Sequence coverage** * Function**** YP_094904lpg08693-hydroxyisobutyryl Coenzyme A hydrolase5.5/ %enzyme YP_095877lpg1851hypothetical protein lpg / %unknown YP_095877lpg1851hypothetical protein lpg / %unknown YP_094904lpg08693-hydroxyisobutyryl Coenzyme A hydrolase5.5/ %enzyme YP_095322lpg1292DNA-binding response regulator5.3/ %transcription regulater YP_094601lpg0560acetyoacetyl CoA reductase5.91/ %enzyme YP_096255lpg2243uracil phosphoribosyltransferase6.19/ %enzyme YP_094620lpg0584hypothetical phosphate transport regulator5.74/ %unknown YP_095092lpg1059acetoacetyl CoA reductase7.53/ %enzyme YP_096287lpg2275hypothetical protein lpg / %unknown YP_094827lpg0791macrophage infectivity potentiator (Mip)9.19/ %Toxin production YP_094942lpg0908flagella basal body P-ring formation protein FlgA8.22/ %motility YP_094827lpg0791macrophage infectivity potentiator (Mip)9.19/ %Toxin production YP_094602lpg0561acetyoacetyl CoA reductase5.85/ %enzyme YP_094935lpg0901hypothetical protein lpg / %unknown YP_094297lpg0243short chain dehydrogenase6.12/ %enzyme

Table S4. (continued) Spot no.* Average Ratio** NCBI accesion no. Gene nameProtein name Theoretical pI/MW SCORE Sequence coverage*** Function**** YP_095993lpg1977intracellular protease, ThiJ/PfpI family5.55/ %enzyme YP_096447lpg2439NADPH-dependent FMN reductase domain protein7.85/ %enzyme YP_095674lpg1647hypothetical protein lpg / %unknown YP_096170lpg2157Sid related protein-like (SDeA)5.88/ % substrate of Icm/Dot YP_096166lpg2153Sid related protein-like (SDeC)5.95/ % substrate of Icm/Dot YP_096166lpg2153Sid related protein-like (SDeC)5.95/ % substrate of Icm/Dot YP_096166lpg2153Sid related protein-like (SDeC)5.95/ % substrate of Icm/Dot YP_094288lpg0234SidE5.95/ % substrate of Icm/Dot YP_094288lpg0234SidE5.95/ % substrate of Icm/Dot YP_094288lpg0234SidE5.95/ % substrate of Icm/Dot *Spot No. indicate the circle numbers in 2D-DIGE gel image (Fig. 1). **Ratio means the ratio of the protein spot intensity at PE to that at E; PE/E. ***Sequence coverage means the ratio of the number of identified amino acid sequence to that of the actual whole amino acid sequence. ****Function was assigned based on functions indicated in NCBInr.