UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

Slides:

Advertisements

Similar presentations

Introduction to Metview

Advertisements

Database Basics. What is Access? Database management system Computer-based equivalent of a manual database Makes it easy to organize and update information.

1 SEDIT & S/REXX SEDIT and S/REXX Mainframe-caliber tools for UNIX Offered by Treehouse Software, Inc.

Chapter 11: The X Window System Guide To UNIX Using Linux Third Edition.

Creating Forms in Microsoft Word Lunch and Learn: April 2, 2008.

Mainframe-caliber tools for UNIX Treehouse Software, Inc.

© 2010 Delmar, Cengage Learning Chapter 1 Getting Started with Dreamweaver.

Microsoft Word: What you need to know for your Legal Analysis Writing and Research (LAWR) Class.

Homework Assignments due next session 1.Find a entry of interest in OMIM ( )

GCG vs EMBOSS Gary Williams. Which is better GCG or EMBOSS? n You must decide for yourselves n You may find other packages that do what you want n Use.

Meeting your new mac. Topics  Why mac?  Desktop  Web browsing  Mac mail  Burning CDs  Getting help.

CGS 1060 Introduction to MicroComputer Usage Chapter 1 Windows 7

Integrating Access with the Web and with Other Programs.

Getting Started with ArcView GIS Introduction to the Laboratory Exercises.

A Guide to Oracle9i1 Introduction To Forms Builder Chapter 5.

A Guide to Oracle9i1 Creating an Integrated Database Application Chapter 8.

Lab 03 Windows Operating Systems (Cont.). PYP002 Preparatory Computer ScienceWindows Operating System2 Objectives Develop a good understanding of 1. The.

Basic Unix Dr Tim Cutts Team Leader Systems Support Group Infrastructure Management Team.

Figure 1. Hit analysis in 2002 of database-driven web applications Hits by Category in 2002 N = 73,873 Results Reporting 27% GME 26% Research 20% Bed Availability.

Word processing June 2013.

Access Tutorial 10 Automating Tasks with Macros

1 ADVANCED MICROSOFT WORD Lesson 15 – Creating Forms and Working with Web Documents Microsoft Office 2003: Advanced.

LEARN THE QUICK AND EASY WAY! VISUAL QUICKSTART GUIDE HTML and CSS 8th Edition Chapter 2: Working with Webpage Files.

ALEPH version Services / Task Manager South Dakota Library Network 1200 University, Unit 9672 Spearfish, SD © South Dakota Library.

File Types, MS Word, and MS Excel

How do people communicate with computers?

ACCESS CHAPTER 1. OBJECTIVES Tables Queries Forms Reports Primary and Foreign Keys Relationship.

XP New Perspectives on Introducing Microsoft Office XP Tutorial 1 1 Introducing Microsoft Office XP Tutorial 1.

1 CA201 Word Application Increasing Efficiency Week # 13 By Tariq Ibn Aziz Dammam Community college.

Getting Started with Application Software

XP Practical PC, 3e Chapter 2 1 Looking at Windows.

MagicInfo Pro Scheduler Now that a template has been created from content imported into the Library, the user is ready to begin scheduling content to.

Introduction To Windows Operating Systems Manipulating Windows GUI

WINDOWS Part 1 – Start Up Basics

Designing Interface Components. Components Navigation components - the user uses these components to give instructions. Input – Components that are used.

FTP Server and FTP Commands By Nanda Ganesan, Ph.D. © Nanda Ganesan, All Rights Reserved.

Basic Computer and Word Functions, part 1 Read the information and use to answer the questions in the Basic Computer and Word Functions Study Guide.

MICRO SOFT WORD.

Key Applications Module Lesson 21 — Access Essentials

Introduction to Enterprise Guide Jennifer Schmidt Rhonda Ellis Cassandra Hall.

Basic Computer and Word Functions, part 1 Read the information and use to answer the questions in the Basic Computer and Word Functions Study Guide.

© 2010 Pearson Education, Inc. | Publishing as Prentice Hall1 Computer Literacy for IC 3 Unit 2: Using Productivity Software Chapter 1: Starting with Microsoft.

Lesson No: 6 Introduction to Windows XP CHBT-01 Basic Micro process & Computer Operation.

1 Chapter 34 Internet Applications (Telnet, FTP).

By Felixberto Dominic B. Eruela.  Using a computer to create, edit, and print documents. Of all computer applications, word processing is the most common.

Chapter Eleven The X Window System. 2 Lesson A Starting and Navigating an X Window System.

Foundation year Practical Lec. 4:Practical Lec. 4: Presentation Software Using Microsoft Office 2007 Practical Lec. 4:Practical Lec. 4: Presentation Software.

Copyright © 2006 Prentice-Hall. All rights reserved.1 Computer Literacy for IC 3 Unit 2: Using Productivity Software Project 1: Taking a Tour of Windows.

Information Security 493. Lab # 4 (Routing table & firewalls) Routing tables is an electronic table (file) or database type object that is stored in a.

 2002 Prentice Hall. All rights reserved. 1 Chapter 2 – Introduction to the Visual Studio.NET IDE Outline 2.1Introduction 2.2Visual Studio.NET Integrated.

FileZilla An open-source success story. Mark Swelstad – Itec400, Winter 2007.

Hands-On Microsoft Windows Server 2008 Chapter 5 Configuring Windows Server 2008 Printing.

Microsoft Office 2008 for Mac – Illustrated Unit D: Getting Started with Safari.

Module 2 Part II Introduction To Windows Operating Systems Manipulating Windows GUI Introduction To Windows Operating Systems Manipulating Windows GUI.

Customizing Menus and Toolbars CHAPTER 12 Customizing Menus and Toolbars.

File and File Systems Compiled by IITG Team Need to be reorganized and reworded.

IE 411/511: Visual Programming for Industrial Applications Lecture Notes #2 Introduction to the Visual Basic Express 2010 Integrated Development Environment.

 2002 Prentice Hall. All rights reserved. 1 Introduction to the Visual Studio.NET IDE Outline Introduction Visual Studio.NET Integrated Development Environment.

Chapter 4: server services. The Complete Guide to Linux System Administration2 Objectives Configure network interfaces using command- line and graphical.

Copyright © 2014 Pearson Canada Inc. Ext. 5b-1 Copyright © 2014 Pearson Canada Inc. Application Extension 5b Using Microsoft Access Part 2: Using Information.

C Copyright © 2009, Oracle. All rights reserved. Using SQL Developer.

Microsoft Word 2010.

MS-Office It is a Software Package It contains some programs like

Multi-host Internet Access Portal (MIAP) Enhancement Guide

Assistant lecturer Nisreen A. Jabr

Using AMOS With SPSS Files.

DB Implementation: MS Access Forms

Setting up home folders and roaming profiles

Presentation transcript:

UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs

UK MRC Human Genome Mapping Project Resource Centre EMBOSS Command line based Options not obvious – must be remembered Jemboss Point and Click interface Portable interface – use with PCs, Mac OSX, UNIX Options listed in program form

UK MRC Human Genome Mapping Project Resource Centre embl:m93650 seqret -sequence em:m sbegin1 0 -send1 0 -nofirstonly -auto >HSPAX6AN M93650 Human paired box gene (PAX6) homologue, complete cds cagaggtcaggcttcgctaatgggccagtgaggagcggtggaggcgaggccggcgccgca cacacacattaacacacttgagccatcaccaatcagcataggaatctgagaattgctctc Remote server Local computer Databases EMBL accession =m93650

UK MRC Human Genome Mapping Project Resource Centre EMBOSS applications Job manager Mode Local file manager Tool bar

UK MRC Human Genome Mapping Project Resource Centre Local file manager

UK MRC Human Genome Mapping Project Resource Centre home directory preferred directory

UK MRC Human Genome Mapping Project Resource Centre

UK MRC Human Genome Mapping Project Resource Centre confirm directory path

UK MRC Human Genome Mapping Project Resource Centre new default directory

UK MRC Human Genome Mapping Project Resource Centre EMBOSS applications

UK MRC Human Genome Mapping Project Resource Centre Select appropriate program from the category menus

UK MRC Human Genome Mapping Project Resource Centre Selection from alphabetical list, using the “Go To” field programs are highlighted based unambiguous letters

UK MRC Human Genome Mapping Project Resource Centre input possibilities calculates nature of sequence and default settings

UK MRC Human Genome Mapping Project Resource Centre Database entry in format database:entry

UK MRC Human Genome Mapping Project Resource Centre drag and drop the file into the sequence field

UK MRC Human Genome Mapping Project Resource Centre File (path) now specified

UK MRC Human Genome Mapping Project Resource Centre cut and paste a sequence from elsewhere

UK MRC Human Genome Mapping Project Resource Centre Mode

UK MRC Human Genome Mapping Project Resource Centre Interactive mode – Jemboss is suspended until program has been completed

UK MRC Human Genome Mapping Project Resource Centre results tab

UK MRC Human Genome Mapping Project Resource Centre input files tab

UK MRC Human Genome Mapping Project Resource Centre command line tab

UK MRC Human Genome Mapping Project Resource Centre

UK MRC Human Genome Mapping Project Resource Centre Saved file. All graphics files MUST be saved with a.png extension

UK MRC Human Genome Mapping Project Resource Centre Job manager Mode

UK MRC Human Genome Mapping Project Resource Centre

UK MRC Human Genome Mapping Project Resource Centre job statusjob is processed in the background

UK MRC Human Genome Mapping Project Resource Centre job status

UK MRC Human Genome Mapping Project Resource Centre

UK MRC Human Genome Mapping Project Resource Centre Results can be saved in exactly the same manner as before. Note: no command line tab

UK MRC Human Genome Mapping Project Resource Centre Tool bar

UK MRC Human Genome Mapping Project Resource Centre

UK MRC Human Genome Mapping Project Resource Centre select an application input file and command line information is displayed Notes on the experiment or analysis may be saved to the server along with the results

UK MRC Human Genome Mapping Project Resource Centre

UK MRC Human Genome Mapping Project Resource Centre

UK MRC Human Genome Mapping Project Resource Centre

UK MRC Human Genome Mapping Project Resource Centre Disable parameters by shading (selected) or removing them (deselected) Auto-refresh. More often for slower connection, less often for a faster connection. Alteration of default home directory path setting

UK MRC Human Genome Mapping Project Resource Centre

UK MRC Human Genome Mapping Project Resource Centre The server settings and environment information should be the same

UK MRC Human Genome Mapping Project Resource Centre

UK MRC Human Genome Mapping Project Resource Centre Default output for Jemboss is fasta format, so this may have to be altered This third party software has also been incorporated into Jemboss

UK MRC Human Genome Mapping Project Resource Centre

UK MRC Human Genome Mapping Project Resource Centre This is the beginnings of a project management system.

UK MRC Human Genome Mapping Project Resource Centre

UK MRC Human Genome Mapping Project Resource Centre The version should always be reported if there are any problems with the program brief user guide