Supplemental Results Online Figure S1. Norepinephrine increases ROS production. (A): H9c2 cells were treated with 10  M norepinephrine and intracellular.

Slides:



Advertisements
Similar presentations
Supplemental figure 1 ROS production in MM cell line (KMM1) treated with bortezomib and DCA. ROS production was marginally increased by DCA in combination.
Advertisements

C Merged α-SMA Vimentin A B Figure S1: Representative immunocytochemistry images of cardiac myofibroblasts from adult rats examined by fluorescence microscopy.
Supplemental Figure 1. Erlotinib does not alter oxygenation of tumors. Tumor pO 2 was measured by phosphorescence lifetime oximetry at times before erlotinib.
Supplemental Material to: Xiaomu Qiao, Isabelle Roth, Eric Féraille and Udo Hasler Different effects of ZO-1, ZO-2 and ZO-3 silencing on kidney collecting.
Atttgaaatgaaggcagaaaccaggcttaaacaaagactgaaactcattctcttttcaaa tctcctgccgataaacatatgtgcccagtcttttgtttcccagacatcaggtttccatta tttaaacagagcttctacctggatctgtcaagagcatgaggcagacatatttaagatttt.
Date of download: 6/23/2016 Copyright © 2016 American Medical Association. All rights reserved. From: Effect of Smad7 Gene Overexpression on Transforming.
Supplemental figure 1 ab CtrlPi * %Cells with GFP-LC3 puncta  -actin LC3I LC3II Ctrl Pi (3 mM) CtrlPi * LC3-II protein.
Arginase I enhances vascular smooth muscle cell proliferation by increasing intracellular polyamine production (A and B) Arginase I enhances cell proliferation.
Supplementary Figure 1. (A) Expression of DSB repair proteins
Figure 1. WA down-regulates H
Online Data Supplement
Figure 6. Effects of exercise training on aging-induced alteration of MaxiK channel activity and gating properties in mesenteric artery myocytes. (A–C)
Invest. Ophthalmol. Vis. Sci ;52(8): doi: /iovs Figure Legend:
Osteoprotegerin Disruption Attenuates HySu-Induced Pulmonary Hypertension Through Integrin αvβ3/FAK/AKT Pathway SuppressionCLINICAL PERSPECTIVE by Daile.
Arterioscler Thromb Vasc Biol
Differential expression of G-protein-coupled estrogen receptor-30 in human myometrial and uterine leiomyoma smooth muscle  Ruijuan Tian, M.Sc., Zengyong.
Calcium regulates ERK nuclear association, but not its activation.
Volume 126, Issue 2, Pages (February 2004)
* * Supplemental Figure S-I Con AS LC3/DAPI
Critical Role of 5-Lipoxygenase and Heme Oxygenase-1 in Wound Healing
Volume 90, Issue 3, Pages (September 2016)
Volume 41, Issue 3, Pages (September 2004)
Volume 133, Issue 6, Pages (December 2007)
Volume 150, Issue 2, Pages (February 2016)
Volume 69, Issue 4, Pages (February 2006)
Volume 124, Issue 7, Pages (June 2003)
Volume 69, Issue 8, Pages (April 2006)
Volume 65, Issue 2, Pages (February 2004)
a b MCF-7 TR2 MCF-7 TR2 (Fold change) MTT Assay , (Fold change)
Induction of pro-angiogenic signaling by a synthetic peptide derived from the second intracellular loop of S1P3 (EDG3)‏ by Tamar Licht, Lilia Tsirulnikov,
Indomethacin Sensitizes TRAIL-Resistant Melanoma Cells to TRAIL-Induced Apoptosis through ROS-Mediated Upregulation of Death Receptor 5 and Downregulation.
Volume 44, Issue 3, Pages (November 2011)
Pioglitazone preserves vein graft integrity in a rat aortic interposition model  Zhi Chen, MD, Tomomi Hasegawa, MD, PhD, Akiko Tanaka, MD, Yutaka Okita,
Volume 14, Issue 6, Pages (December 2011)
Volume 79, Issue 10, Pages (May 2011)
Volume 12, Issue 3, Pages (July 2015)
Sphingosine-1-phosphate–induced oxygen free radical generation in smooth muscle cell migration requires Gα12/13 protein-mediated phospholipase C activation 
Volume 20, Issue 1, Pages (October 2005)
Tumor necrosis factor α up-regulates endometrial milk fat globule–epidermal growth factor 8 protein production via nuclear factor κB activation, resulting.
PMI: A ΔΨm Independent Pharmacological Regulator of Mitophagy
Autophagy Links Inflammasomes to Atherosclerotic Progression
Suppression of Vitamin D Receptor and Induction of Retinoid X Receptor α Expression During Squamous Differentiation of Cultured Keratinocytes  Siegfried.
Estrogenic regulation of testicular expression of stem cell factor and c-kit: implications in germ cell survival and male fertility  Sara Correia, M.S.,
Rafael Gongora, Robert P Stephan, Zhixin Zhang, Max D Cooper  Immunity 
Volume 130, Issue 3, Pages (March 2006)
(red) & endothelium (green) PMCA4 (green) & DAPI (blue)
Volume 139, Issue 1, Pages e2 (July 2010)
HPV‐E7 targets RB for induction of ceramide‐dependent mitophagy
Volume 119, Issue 2, Pages (August 2000)
Volume 54, Issue 2, Pages (August 1998)
Volume 129, Issue 2, Pages (April 2007)
MAPK14 regulates ROS generation in GS cells.
gp91-phox (Santa Cruz sc-5827)
Absence of miR‐21 in macrophages promotes foam cell formation
Fig. 2. Ex vivo inducible knockout of PDCD2 in ESCs results in loss of S phase entry and increased p53.(A) Growth curve of inducible knockout and WT ESCs.
Identification of Z-FA-FMK as a potent compound that increases SMN protein expression in HEK293 and patient fibroblast cells. Identification of Z-FA-FMK.
Reversal of MOR lysosomal targeting by silencing enhanced Rab7 expression. Reversal of MOR lysosomal targeting by silencing enhanced Rab7 expression. A:
Effect of 14 hit compounds on SMN protein expression in type I SMA patient fibroblast cells (GM03813). Effect of 14 hit compounds on SMN protein expression.
Expression and Activity of Methylation-Associated Proteins In Vivo and In Vitro (AandB) The protein level of methylation-associated proteins (DNMT1, DNMT3a,
Volume 126, Issue 2, Pages (February 2004)
Unmodified Cadmium Telluride Quantum Dots Induce Reactive Oxygen Species Formation Leading to Multiple Organelle Damage and Cell Death  Jasmina Lovrić,
Volume 77, Issue 5, Pages (March 2010)
Capsinoids (CSNs) and mild cold exposure synergistically promote beige adipocyte biogenesis in inguinal WAT. A: Relative mRNA expression levels of Ucp1,
Aβ-mediated Ras-MAPK signaling and Cyclin D1 expression in B103 cells are dependent on APP expression and can be reversed with MEK or Ras inhibition. Aβ-mediated.
Differential effects of simvastatin on mesangial cells
Quantification of NMT knockdown.
Fig. 8 C9orf72 knockdown results in an increase in autophagic flux.
RT-PCR and Western blot analysis of cIAP2 mRNA and protein expression in ovarian cancer cells. RT-PCR and Western blot analysis of cIAP2 mRNA and protein.
Enhanced expression of Cap43 gene by nickel in breast cancer cell lines. Enhanced expression of Cap43 gene by nickel in breast cancer cell lines. Expression.
Fig. 5 C9orf72 knockdown disrupts autophagy induction.
Presentation transcript:

Supplemental Results Online Figure S1. Norepinephrine increases ROS production. (A): H9c2 cells were treated with 10  M norepinephrine and intracellular ROS levels were measured with DCF-DA at different time points (4, 10, 16, 24, 36 and 48 hours). (B) H9c2 cells were treated with norepinephrine (NE) for 16 hours in the absence or presence of prazosin (1  M). ROS were measured with DCF-DA. Data are mean  SEM, n = 6. * P < 0.05 vs. control. Online Figure S1 B A 1

Online Figure S2 Online Figure S2. Norepinephrine increases ROS production. H9c2 cells and isolated intact fetal hearts (ex vivo) were treated with 10  M norepinephrine (NE) in the absence or presence of N-acetylcysterine (NAC, 1 mM), apocynin (Apo, 0.5 mM) or diphenyleneiodonium (DPI, 10 μM) for 16 hours. ROS were measured with the quantification of confocal images of dihydroethidium (DHE) fluorescence. (A): H9c2 cells. (B): ex vivo fetal hearts. Data are mean  SEM, n = 8. * P < 0.05 vs. control. A B 2

Online Figure S3. Effect of norepinephrine on Egr-1 and Sp1 protein abundance. H9c2 cells were treated with 10  M norepinephrine (NE) for 48 hours. Cytosol and nuclear protein abundance of Egr-1 and Sp1 was determined with Western blot. Data are mean  SEM, n = 4. Online Figure S3 3

Nox1 Nox2 Nox4  -actin Protein:  g H9c2 aorta Nox2 actin A B Control NE Fetal hearts aorta Nox2 actin C Online Figure S4. Expression of Nox1, Nox2 and Nox4 in fetal hearts and H9c2 cells. (A): Nox2 protein expression was readily detected in rat aortic smooth muscle but not in H9c2 cells. (B): mRNA of Nox1 and Nox4, but not Nox2, was detected in H9c2 cells. (C): Nox2 protein expression was detected in rat aortic smooth muscle but not in isolated fetal rat hearts in the absence or presence of 10  M norepinephrine (NE) for 48 hours. Online Figure S4 4