LMRFC Training RFC Tech Transfer Workshop August 2007.

Slides:



Advertisements
Similar presentations
How to enter the world of Python Programming for ArcGIS Or, a funny thing happened on the way from an ESRI conference By Katherine Paybins WVAGP Membership.
Advertisements

How to Install & Join a WebEx Demo Last updated: 17 th February 2014.
WinTR-20 Course February Muskingum-Cunge Flood Routing Procedure in NRCS Hydrologic Models Prepared by William Merkel USDA-NRCS National Water Quality.
Applications of the NWS FLDWAV Model. Teton Dam Failure on Snake River.
US Army Corps of Engineers BUILDING STRONG ® Methods for Determining Maximum Flood Elevations Landward of Failed Levees: An Example from the Great Missouri.
1 GIS Workshop Tuesday, August 15, 2006 Presented by David Valentine Chris Condit Presented by David Valentine Chris Condit.
Title Center for Coastal and Ocean Mapping NOAA/UNH Joint Hydrographic Center Windows Python Tutorial Kurt Schwehr Jan 2007.
Use of GIS at the Northwest River Forecast Center Portland, OR Steve King Hydrologist, NWRFC.
Title Center for Coastal and Ocean Mapping NOAA/UNH Joint Hydrographic Center Windows Python Tutorial Kurt Schwehr Jan 2007.
GIS for Faster Analysis of Dam-Break Flows Steve Pitman GIS in Water Resources – Fall 2003 Dr. David Maidment – UT Austin.
ArcServer Kris Lander Central Region HQ RFC GIS Workshop July 2007.
Hydrologic Routing Reading: Applied Hydrology Sections 8.1, 8.2, 8.4.
Reading: Applied Hydrology Sections 8.1, 8.2, 8.4
Where Policy Meets Process Presented by: Michelle Running.
William B. Reed Senior Hydrologist Colorado Basin River Forecast Center CBRFC Support for Dam Breaks DamBreak and EAPs Arizona 2011 Spring Hydrology Seminar.
NWS Calibration Workshop, LMRFC March, Historical Data Access Basic Calibration Workshop March 10-13, 2009 LMRFC.
10 Tips for keeping MCL safe 1. Set up your defenses. Do you have adequate firewalls and antivirus software to protect you from hackers who could steal.
Computing For Biology An online course for A-level students Runs 18 th to 29 th August 2014 TCGATTCCAGAACTAGGCATTATAGATAGATTCAG ATAGGACATAGATCGATTCAGATAGGATATAATCG.
David Ramirez, P.E. Senior Hydrologist Lower Mississippi River Forecast Center Slidell, LA Real-Time Operation of HEC-RAS at the Lower Mississippi River.
LMRFC GIS Activities Currently generate ~ 4,500 web graphics daily via ArcView 3.1 Avenue and ArcGIS standalone VB and ArcGIS VBA scripts. Used to support.
1 Hydro Training Status HSD Meeting February 23, 2010 Mark Glaudemans OCWWS/HSD.
Network Analysis with Python
ArcGIS Data Reviewer : Leveraging Geoprocessing for data validation
V11.4 Upgrade Training Training Options Training options for following groups: DTF members or designated staff Staff - 2 -
A JOINT PROJECT OF MISSISSIPPI STATE UNIVERSITY AND the Lower Mississippi River Forecast Center PROJECT FUNDED BY NOAA/OAR THROUGH THE NORTHERN GULF INSTITUTE.
EDGE Institute 2014 Hour of Code Session 9:35-10:30 Instructor: Nicole Bonnell.
ArcGIS Pro: A Quick Tour of Python David Wynne.
A U.S. Department of Energy Office of Science Laboratory Operated by The University of Chicago Argonne National Laboratory Office of Science U.S. Department.
Basic education 1 1.Course Agenda 2.centric Features 3.Advanced Macro Programming 4.Scripting SessionWorkshop Course Agenda -Creating and using advanced.
March 2009WinTR-20 Course1 Muskingum-Cunge Flood Routing Procedure in NRCS Hydrologic Models Prepared by William Merkel USDA-NRCS National Water Quality.
Esri Production Mapping: Automate Map Production With ArcGIS Workflow Manager Joe Sheffield.
The Power of Computer Coding for Elementary GT Students a hands on workshop Ann E. Durkin – Technology/Gifted and Talented Teacher, Johnson Elementary/
NASA Applied Remote Sensing Training (ARSET) Dr. Ana I. Prados University of Maryland Baltimore County, Joint Center for Earth Systems Technology and NASA/GSFC.
An ArcIMS based Hurricane Tracker Application EMHURR Ira Graffman NWS Office of Science & Technology John Kozimor QSS Group.
OCR GCSE Computing © Hodder Education 2013 Slide 1 OCR GCSE Computing Python programming 1: Introduction.
Introduction Presenter: James Zollweg, Ph.D. Associate Professor of Water Resources and GIS The College at Brockport NYS GIS Association – Python Training,
Esri UC 2014 | Technical Workshop | Creating Geoprocessing Services Kevin Hibma.
Logistical Verification Forecast Services in IHFS Mary Mullusky RFC Verification Workshop, August
National Weather Service Hydrologic Forecasting Course Agenda 14 October – 7 November 2003.
DAM FAILURE TOOL TRAINING AT THE NERFC National HIC Meeting July 2006.
Flood Forecast Mapping in AHPS October 28, /28/2003MARFC/NWS/NOAA Outline Definition Requirements Processing Tasks –One-time –Routine Test Area.
Mir Rosenberg & Refaat Issa Program Managers Microsoft Corporation SESSION CODE: WSV401.
Unix Users Meeting June 28 th,2006. CD/CSS/CSI Fermi National Accelerator Lab Training Update Upcoming Classes: –Verilog Introduction, August 7 & 8, 2006.
FLOOD ROUTING Flood Routing Techniques Siti Kamariah Md Sa’at PPK Bioprocess
River Mechanics Activities River Mechanics Group Hydrology Laboratory Office of Hydrologic Development National Weather Service National Oceanic and Atmospheric.
ERT 246 Hydrology & Water Resources Eng.
ArcGIS Workflow Manager: Integrating Geoprocessing into Your Business Processes Nishi Mishra.
2010 Organic Pest Management Training Events
Software Engineering for Data Scientists
03/02/2006 Flow Routing Reading: 8.1, 8.4, 9.1, 9.2.
Demonstrate Proficiency
Creating Geoprocessing Services
Python Training Institutes in Hyderabad Python Training Institutes in Hyderabad.
Geoprocessing with ArcGIS for Server
How to enter the world of Python Programming for ArcGIS
Class: ArcGIS II Date: September , 2003 Cost : $195.00
Classes: ESRI Building Geodatabases I &2
Today’s lesson – Python next steps
Hydrology.
MCE 372 Engineering Analysis
ArcGIS II June , 2003 Cost $ Location: Stennis Space Center
Scientific Python Introduction
Tech Ed North America /12/2019 6:45 AM Required Slide
Network Analysis using Python
ModelBuilder – Getting Started
Best Practice for Geoprocessing Service
ModelBuilder – Getting Started
Class: ArcGIS II July Cost $195.00
UW WRF mbar forecasts.
YouTube Search for Python and ArcGIS
Presentation transcript:

LMRFC Training RFC Tech Transfer Workshop August 2007

Dambreak Rules of Thumb In-House Basic OFS Local Low Cost Training LMRFC Training

Dambreak Rules of Thumb Author - David Welch 3 teletraining sessions Available on LAD Interactive GUI – AWIPS or Windows

Rules of Thumb GUI Provides documentation and guidance on Rules of Thumb forecast (wave height, attenuation and travel time). Compute estimates of breach width and breach time based on historical regression equations for use in SMPDBK, FLDWAV or HEC-RAS dambreak runs. Compute estimated peak outflow based on historical regression equations. Compute estimated flood wave travel time. Compute and plot a typical breach hydrograph based on estimated peak flows. Coded in Python - will run on AWIPS as is or on PC with Python installed.

Rules of Thumb GUI Documentation is built in

In-House Basic OFS Goal – provide new employee training 20 hrs of course time Used combo of Basic/Advanced Workshops NERFC/RTI Advanced OFS slides used HL “presentation” website Demo’ed examples with mostly hands-on Useful in kick-starting

Available Low Cost Training CSC Stennis or Charleston PRCC LMRFC trained - 12

Coastal Services Center Free training ~ 20 students per class ArcGIS I –last planned, Aug ArcGIS II –none planned Coastal Applications –last planned, August LMRFC trained – 10 total

PRCC Training Generally, at SSC or USM Gulfport 3-5 day courses Low cost - $250 Intro to ArcGIS I Intro to ArcGIS II Intro to Geoprocessing Scripts Using Python Fundamentals of Remote Sensing LMRFC trained – 2 total