Essential Basic Part Types Coding Sequences (C) - Complete open reading frames (type I), or sequences encoding polypeptides but lacking either a stop codon.

Slides:

Advertisements

Similar presentations

The Central Dogma of Genetics

Advertisements

Chapter 17~ From Gene to Protein

Protein Synthesis.

Central Dogma Big Idea 3: Living systems store, retrieve, transmit, and respond to info essential to life processes.

Cell Division, Genetics, Molecular Biology

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.

Promoters Information about where to start transcription.

I.1 ii.2 iii.3 iv.4 1+1=. i.1 ii.2 iii.3 iv.4 1+1=

I.1 ii.2 iii.3 iv.4 1+1=. i.1 ii.2 iii.3 iv.4 1+1=

8 The Molecular Genetics of Gene Expression. Fig. 8.6c Transcription Elongation.

Biological Information Flow

RNA and Protein Synthesis

GENE: RNA polymerases and transcription factors. Structure of genes Prokaryotic and eukaryotic genes differ in their structure, however there are a number.

Fig. 12-2, p.187. Fig. 12-5, p.190 Fig. 12-6, p nanometer diameter overall 0.34-nanometer distance between each pair of bases 3.4-nanometer length.

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

1 PROTEIN SYNTHESIS CHAPTER 10 section 4. 2 Starting with DNA DNA ‘s code must be copied and taken to the cytoplasmDNA ‘s code must be copied and taken.

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

MOLECULAR GENETICS Polypeptide Synthesis Protein Structure Sequence of amino acids Nucleotide Connection Sequence of nucleotides in the gene determines.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

RNA & PROTEIN SYNTHESIS Chapter 12 Section 3 Pages

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

Replication Transcription Translation

Protein Synthesis Chapter Protein synthesis- the production of proteins The amount and kind of proteins produced in a cell determine the structure.

1 PROTEIN SYNTHESIS. DNA and Genes 2 Genes & Proteins DNA contains genes, sequences of nucleotide bases These genes code for polypeptides (proteins)

From Genomes to Genes Rui Alves.

DNA and Translation Gene: section of DNA that creates a specific protein Approx 25,000 human genes Proteins are used to build cells and tissue Protein.

Adv Biology 1-2. Translation  Translation-the transfer of information from an RNA molecule into a polypeptide. Using the information in RNA to make a.

Chapter 10: DNA, RNA and Protein Synthesis

Amino acids are coded by mRNA base sequences.

Chapter 17 From Gene to Protein. 2 DNA contains the genes that make us who we are. The characteristics we have are the result of the proteins our cells.

3.A.1 DNA and RNA Part IV: Translation DNA, and in some cases RNA, is the primary source of heritable information. DNA, and in some cases RNA, is the primary.

DNA, RNA, and Protein Replication Transcription Translation.

copyright cmassengale

Translation 7.3. Translation the information coded in mRNA is translated to a polypeptide chain.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

TRANSLATION. Cytoplasm Nucleus DNA Transcription RNA Translation Protein.

Translation – Initiation

Gene Expression II. Translation Overview Conversion of triplet code into polypeptide Takes place at ribosome in cytoplasm Involves all 3 types of RNA.

Chapter – 10 Part II Molecular Biology of the Gene - Genetic Transcription and Translation.

Chapter 17: From Gene to Protein AP Biology Mrs. Ramon.

Cell Growth and Reproduction, and Protein Synthesis.

Aim: How are proteins synthesized?

Translation – Protein Synthesis

What is Transcription? Transcription is the transfer of genetic information from DNA into messengerRNA (mRNA). It occurs in the nucleus of the cell.

PROTEIN SYNTHESIS CHAPTER 10 section 4

13.3 RNA & Gene Expression I. An Overview of Gene _____________ A. RNA

13.3 RNA & Gene Expression I. An Overview of Gene Expression A. RNA

Protein Synthesis.

10-3 Protein Synthesis Together, all 3 types of RNA synthesize proteins. Proteins are polymers. Polypeptides linked by peptide bonds. Made of 20 different.

Translation Genetic code converted from the “language” of mRNA to the “language” of protein. - a protein is a string of amino acids.

Chapter 14~ From Gene to Protein

Transcription & Translation.

Big picture of protein synthesis

Protein Synthesis Step 2: Translation

5-5 NOTES: TRANSLATION RNA  PROTEIN

A: OAZ1 mRNA transcript of 775-1, and parental cell lines showing the stop codon introduced by the nonsense mutations in the and transcripts,

(Transcription & Translation)

Title of notes: Transcription and Translation p. 16 & 17

Protein Synthesis Translation

Section 8-5 “Translation”

RNA, Ribosomes, And Protein synthesis

CHAPTER 17 FROM GENE TO PROTEIN

Lecture #7 Date _________

LAST UNIT! Energetics.

Protein Synthesis.

Shifty Ciliates Lawrence A. Klobutcher, Philip J. Farabaugh Cell

Section 13.2 Protein Synthesis.

Protein Synthesis.

Presentation transcript:

Essential Basic Part Types Coding Sequences (C) - Complete open reading frames (type I), or sequences encoding polypeptides but lacking either a stop codon (type II), a start codon (type III), or both (type IV) Ribosome Binding Sites (RBS) - Sequence encoding a ribosome binding site, fused 5' to an ORF part Terminators (TT) - Sequence causing transcription termination (and more can come later, with their own part definitions and standards rules)

Potter Standard Polylinker AGATCTPARTSEQUENCE1GGATCC AGATCTPARTSEQUENCE2GGATCC GlySer AGATCTPARTSEQUENCE1GGATCTPARTSEQUENCE2GGATCC GAATTCaaaAGATCTPARTSEQUENCE1GGATCCaaaCTCGAG

Type I Coding Sequences AGATCTATG_MIDDLE_OF_PART_TAAGGATCC AGATCTGTG_MIDDLE_OF_PART_TGAGGATCC  The start and stop codons are placed directly adjacent to the BglII and BamHI sites, respectively  Start codons are free to be ATG, CTG, TTG, or GTG

Coding Sequences Type II AGATCTATGAAATTTCCCGGGAAATTTGGATCC Type III AGATCTCATCATCATCATCATCATTAAGGATCC Type IV AGATCTAAATTTCCCGGGAAATTTCCCGGATCC  Coding sequences allow the construction of ORF fusions for chimeric and tagged proteins. GlySer scars separate junctions between fused peptides.

Ribosome Binding Sites AGATCTGAAAGAGGAGAAAGGATCC  The spacing of a ribosome binding site relative to the start codon is fixed. Shown is a (likely) strong RBS AGATCTATG_ORF_Part_TAAGGATCC.RBS. AGATCTGAAAGAGGAGAAAGGATCTATG_ORF_Part_TAAGGATCC

Promoters +1 | AGATCTTCC_Middle_of_Ptet_TAGAGATACTGAGCACGGATCC  The transcriptional start site (+1) is located at the position directly 5' to the BamHI site (whenever possible)

Terminators...CUUUCUGCGUUUAUA3' | AGATCTCCA_Middle_of_Ptet_CTTTCTGCGTTTATAGGATCC  The transcriptional termination site is located at the position directly 5' to the BamHI site (whenever possible)