Essential Basic Part Types Coding Sequences (C) - Complete open reading frames (type I), or sequences encoding polypeptides but lacking either a stop codon (type II), a start codon (type III), or both (type IV) Ribosome Binding Sites (RBS) - Sequence encoding a ribosome binding site, fused 5' to an ORF part Terminators (TT) - Sequence causing transcription termination (and more can come later, with their own part definitions and standards rules)
Potter Standard Polylinker AGATCTPARTSEQUENCE1GGATCC AGATCTPARTSEQUENCE2GGATCC GlySer AGATCTPARTSEQUENCE1GGATCTPARTSEQUENCE2GGATCC GAATTCaaaAGATCTPARTSEQUENCE1GGATCCaaaCTCGAG
Type I Coding Sequences AGATCTATG_MIDDLE_OF_PART_TAAGGATCC AGATCTGTG_MIDDLE_OF_PART_TGAGGATCC The start and stop codons are placed directly adjacent to the BglII and BamHI sites, respectively Start codons are free to be ATG, CTG, TTG, or GTG
Coding Sequences Type II AGATCTATGAAATTTCCCGGGAAATTTGGATCC Type III AGATCTCATCATCATCATCATCATTAAGGATCC Type IV AGATCTAAATTTCCCGGGAAATTTCCCGGATCC Coding sequences allow the construction of ORF fusions for chimeric and tagged proteins. GlySer scars separate junctions between fused peptides.
Ribosome Binding Sites AGATCTGAAAGAGGAGAAAGGATCC The spacing of a ribosome binding site relative to the start codon is fixed. Shown is a (likely) strong RBS AGATCTATG_ORF_Part_TAAGGATCC.RBS. AGATCTGAAAGAGGAGAAAGGATCTATG_ORF_Part_TAAGGATCC
Promoters +1 | AGATCTTCC_Middle_of_Ptet_TAGAGATACTGAGCACGGATCC The transcriptional start site (+1) is located at the position directly 5' to the BamHI site (whenever possible)
Terminators...CUUUCUGCGUUUAUA3' | AGATCTCCA_Middle_of_Ptet_CTTTCTGCGTTTATAGGATCC The transcriptional termination site is located at the position directly 5' to the BamHI site (whenever possible)