Copyright © John Wiley and Sons, Inc. All rights reserved. Cells and Tissues Chapter 3 Visualizing A & P.

Slides:

Advertisements

Similar presentations

DNA RNA Double stranded molecule Contains thymine

Advertisements

Nucleus Control center of the cell –contains the “genetic library” encoded in the sequences of nucleotides in molecules of DNA code for the amino acid.

Cell Division, Genetics, Molecular Biology

Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 3 Cell Structures and Their Functions Dividing Cells.

The Three T’s 1. Transcription 2. Translation 3. Termination

PROTEIN SYNTHESIS.

Making Proteins Cell Structure (80% of cell membrane is proteins) Transport Channels Cell Processing Hormones (signals) Enzymes What else?

DNA and Protein Synthesis. DNA Does 2 Important Things in a Cell: 1)DNA is capable of replicating itself. Every time a cell divides, each DNA strand makes.

17.4 – Protein Synthesis and Gene Expression gene expression – the transfer of genetic information from DNA to protein As described.

Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.

Trait Chapter 12 Section 3. Ribonucleic acid Responsible for the movement of genetic information from the DNA in the nucleus to the site of protein.

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

FROM DNA TO PROTEIN Transcription – Translation We will use:

Hemophilia- Caused by a defect in a single gene cannot produce all the proteins necessary for blood clotting Depend on expensive injections of clotting.

Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.

Do Now: Do Now: 1. What structure makes proteins? 2. Where are these found? 3. Where is DNA stored? 4. Why not in cytoplasm? Homework: read 12-3 and complete.

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

Making Proteins From DNA to Protein. What is transcription? Transcription = The process of making RNA from DNA’s instructions.

Transcription DNA  mRNA. Review What was the purpose for DNA replication? What was the purpose for DNA replication? So cell division (mitosis & meiosis)

FROM DNA TO PROTEIN Transcription – Translation. I. Overview Although DNA and the genes on it are responsible for inheritance, the day to day operations.

RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.

CFE Higher Biology DNA and the Genome Translation.

Protein Synthesis 1 Background Information All information is stored in DNA All information is stored in DNA RNA “reads” the DNA code RNA “reads” the.

Protein Synthesis The majority of genes are expressed as the proteins they encode. The process occurs in 2 steps: 1. Transcription (DNA---> RNA) 2. Translation.

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

Protein Synthesis Chapter Protein synthesis- the production of proteins The amount and kind of proteins produced in a cell determine the structure.

1 PROTEIN SYNTHESIS. DNA and Genes 2 Genes & Proteins DNA contains genes, sequences of nucleotide bases These genes code for polypeptides (proteins)

RNA (ribonucleic acid) – single stranded nucleotide chain – ribose sugar – G-C and A-U – Uracil instead of Thymine – Different types: – mRNA, tRNA, rRNA.

How does DNA control cell activities?. Protein Production The sequence of nucleotides in DNA contains instructions for producing proteins. The sequence.

Cell Protein Production. Transcription : process of mRNA formation. 1. Triggered by chem. messengers from cytoplasm which bind to DNA 2. This causes release.

Mitosis and Protein Synthesis. Cell Division Occurs in humans and other organisms at different times in their life. Cell Division differs depending on.

Structure of DNA DNA is made up of a long chain of nucleotides

Protein Synthesis Notes Two stage processing of information from DNA to proteins  Gene Expression Molecular Genetics Unit om/watch?v=suN-

RNA (ribonucleic acid)

RNA Ribonucleic Acid. Question Question 1.Use the following diagram to locate the nucleus and ribosomes on the cell.

DNA was discovered in 1953 by James Watson and Francis Crick.

DNA and the Genetic Code 46 molecules of DNA are located in the nucleus of all cells in the human body except sperm and oocytes –23 molecules are inherited.

DNA and Protein Synthesis A blueprint for life. Protein Synthesis is divided into 2 parts in Eukaryotes:Transcription and Translation Transcription is.

Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

DNA Replication DNA helix unwinds from histones DNA helix unwinds from histones Helicase untwists the double helix and exposes complementary strands Helicase.

Protein Synthesis Who am I? How was I formed? Where’s my mom? A molecular model of the YiiP zinc transporter protein with bound zinc ions (red spheres).

Cell Growth and Reproduction, and Protein Synthesis.

A closer look at transcription and translation

Transcription, RNA Processing, & Translation

Section 20.2 Gene Expression

Transcription, RNA Processing, & Translation

PROTEIN SYNTHESIS CHAPTER 10 section 4

How to Make a Protein?.

7.3 Translation.

RNA, & Protein Synthesis

Lesson starter Name the four bases found in DNA

Translation 2.7 & 7.3.

Chp: 12 Transcription & Translation

Transcription & Translation.

Amino Acid Activation And Translation.

Biology Chapter 10 Section 1 Part 2

Translation The sequence of nucleotide bases in an mRNA molecule is a set of instructions that gives the order in which amino acids should be joined to.

copyright cmassengale

Transcription Steps to Transcribe DNA:

GENE EXPRESSION / PROTEIN SYNTHESIS

copyright cmassengale

Cell protein production

DNA & Gene Expression Transcription & Translation

Cell protein production

Translation The sequence of nucleotide bases in an mRNA molecule is a set of instructions that gives the order in which amino acids should be joined to.

Presentation transcript:

Copyright © John Wiley and Sons, Inc. All rights reserved. Cells and Tissues Chapter 3 Visualizing A & P

Copyright © John Wiley and Sons, Inc. All rights reserved. Plasma Membrane

Copyright © John Wiley and Sons, Inc. All rights reserved. Transport Interactions Animations Transport Across the Plasma Membrane You must be connected to the internet to run this animation.

Copyright © John Wiley and Sons, Inc. All rights reserved. Pumps Use energy from ATP hydrolysis Sodium-potassium pump Hydrolysis= Brk apart molecules w/ H2O

Copyright © John Wiley and Sons, Inc. All rights reserved. Parts of a Cell

Copyright © John Wiley and Sons, Inc. All rights reserved. Ribosomes Made from RNA and proteins in nucleolus of cell nucleus Locations in cell  Associated with the rough endoplasmic reticulum  In mitochondria  Free floating in cytosol Function: protein manufacturing

Copyright © John Wiley and Sons, Inc. All rights reserved. Ribosomes

Copyright © John Wiley and Sons, Inc. All rights reserved. Proteins Made of long chains of subunits called amino acids  20 different kinds of amino acids that humans use  Typical protein has ~100 amino acids linked in chains Chemical properties for a specific protein depend on its structure

Copyright © John Wiley and Sons, Inc. All rights reserved. Protein – 3 Dimensional Structure The actual sequence of amino acids in a protein is called = primary sequence The coiling and bending determine the proteins = secondary structure In most proteins, entire chain folds into a compact mass called= tertiary structure When two or more folded proteins combine to form clusters, the mix of proteins form a = quaternary structure

Copyright © John Wiley and Sons, Inc. All rights reserved. Protein -3 Dimensional Structure Ex. Structure of the Protein Insulin exists in 4 Levels

Copyright © John Wiley and Sons, Inc. All rights reserved. Protein Function: Structural role in organisms  Cartilage and tendons made of protein called collagen  Matrix of our skin and bones made of protein  Protein called keratin forms horns on rhinos, feathers on birds, and hair on humans Acts as an enzyme  Enzymes -increase rate a chm rxn occurs  Most chm rxns nessessary for growth, movement, and other body activities would not take place without enzymes

Copyright © John Wiley and Sons, Inc. All rights reserved. Proteins made in Complex Process Like building a house…  Need set of plans –architectural firm  Plan transcribed into blueprints which are taken to home site  Workers bring materials according to blueprints  Essentially translating information in blueprint into final product

Copyright © John Wiley and Sons, Inc. All rights reserved. Protein Synthesis Transcription (Nucleus)  Instructions for creating protein conveyed from DNA to messenger RNA (mRNA) Translation (Ribosomes)  mRNA carries instructions to ribosomes, and with the help of transfer RNA (tRNA), the appropriate amino acids bind together in a specific sequence to create a protein

Copyright © John Wiley and Sons, Inc. All rights reserved. Transcription Preparing for transcription  In the nucleus, DNA encodes instructions for protein synthesis  Nucleotides in DNA sequence specifies which amino acids in which order will be in the protein

Copyright © John Wiley and Sons, Inc. All rights reserved. Transcription  Codon = 3 nucleotides ‘codes’ for an amino acid  DNA cannot leave the nucleus, therefore mRNA is then made as a copy of the DNA in the nucleus = transcription RNA polymerase bind to DNA at the promoter region RNA polymerase moves along DNA strand, making a copy, as mRNA nucleotides pair with complimentary DNA nucleotides At the terminator region, RNA polymerase stops, falls off the DNA, and releases the mRNA that was made The mRNA has a nucleotide sequence that is complimentary to the DNA sequence, and has ‘transcribed’ instructions for the amino acid order to make the specific protein The mRNA leaves through nuclear pores and goes to the ER

Copyright © John Wiley and Sons, Inc. All rights reserved. Transcription

Copyright © John Wiley and Sons, Inc. All rights reserved. Translation Preparing for translation  Ribosomes attach to the mRNA at the start sequence (AUG) and move along mRNA strand  tRNA bound to specific amino acids enter the ribosome  Anticodons on tRNA are complimentary to the codon on the mRNA

Copyright © John Wiley and Sons, Inc. All rights reserved. Translation  Anticodons of the tRNA pair up with appropriate mRNA codons  Peptide bond formation occurs through dehydration synthesis between amino acids in the ribosome  Empty tRNA leaves and process repeats until the protein is made  Ribosome reaches a stop codon in mRNA (UGA, UAG, UAA)  Ribosome breaks apart and releases the synthesized protein Dehydration Synthesis –removing a H2O molecule to join atoms together and make a molecule

Copyright © John Wiley and Sons, Inc. All rights reserved. Translation Covalent Chemical Bond formed between two molecules when carboxyl group (COOH) of 1 molecule rxts with amino grp (NH2) of other molecule causing release of H2O (Dehydration Synth)

Copyright © John Wiley and Sons, Inc. All rights reserved. Protein Synthesis Interactions Animation Protein Synthesis You must be connected to the internet to run this animation.

Copyright © John Wiley and Sons, Inc. All rights reserved. Cell Cycle Interphase  G1 = growth phase Protein synthesis  S = DNA replication  G2 = another growth phase Protein synthesis Mitosis  Prophase  Metaphase  Anaphase  Telophase

Copyright © John Wiley and Sons, Inc. All rights reserved. Cell Division Mitosis  Somatic cell division; diploid cells (23 pairs of chromosomes = 46 chromosomes) Meiosis  Gamete cell division; haploid cells (23 unpaired chromosomes)

Copyright © John Wiley and Sons, Inc. All rights reserved.

Mitosis

Copyright © John Wiley and Sons, Inc. All rights reserved. Mitosis

Copyright © John Wiley and Sons, Inc. All rights reserved. Mitosis

Copyright © John Wiley and Sons, Inc. All rights reserved. Mitosis

Copyright © John Wiley and Sons, Inc. All rights reserved. Mitosis

Copyright © John Wiley and Sons, Inc. All rights reserved. Mitosis

Copyright © John Wiley and Sons, Inc. All rights reserved. Meiosis

Copyright © John Wiley and Sons, Inc. All rights reserved. Mitosis vs. Meiosis

Copyright © John Wiley and Sons, Inc. All rights reserved. Cell Division Interactions Animation The Cell Cycle and Division Processes You must be connected to the internet to run this animation.