Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of.

Slides:



Advertisements
Similar presentations
Actin PEA Hey KOC-7c OVCA420 OVCA432 OVTOKO RMG-1 SKOV3.ip1 Supplementary Fig. S1. Expression level of endogenous PEA-15 in ovarian cancer cell.
Advertisements

+E2 +TAM 21 Up-regulated genes 14 Down-regulated genes Microarray Gain of functionLoss of function PAX2 OverexpressionRNAi Cell proliferation Tumor growth.
Supplementary Online Information. SOI Fig 1 Preliminary microarray data on dysregulation of angiogenic proteins by butyrate In a preliminary experiment,
ER  HSP90 DMSO 200  M I3C30  M DIM200  M TRYPTOPHOL Supplemental Figure 1. DIM and Tryptophol fail to induce the downregulation of ER  seen with I3C.
Supplementary Figure 1. Supplementary Figure 2 Suppl. Fig. 1. The promoter of miR-155 encoding Bic gene contains two putative NF-  B binding sites.
Mandal CC et al Supplementary Fig. S1. Increased expression of CSF-1 in human breast cancer cells. (A) The conditioned media from normal human breast epithelial.
Supplemental Figure S1: Diagram to show previously reported interactions between EGFR and 23 other Egr1 target genes using Pathway Studio, Ariadne Inc.
B Supplementary Fig S1. (A) ZR75- and MCF7-PELP1 knockdown cells were generated as described in methods section. Pooled colonies were analyzed for PELP1.
Normal skin tissue Supplementary Fig 1A KLF4 has a tumor suppressive function in human skin cancer. Skin cancer tissues were deparaffinized and IHC was.
Supplementary Fig. 1. RT-PCR showed that tumor tissues have elevated Mst1 mRNA levels in most of the HCC patients tested. GAPDH RT-PCR products were shown.
Fig. S1 Beclin1, ATG3 and LC3B mRNA -real-time quantitative PCR HCT-116 HT-29.
Date of download: 6/25/2016 Copyright © 2016 American Medical Association. All rights reserved. From: Implication of SSAT by Gene Expression and Genetic.
Wu et al., Supplementary Fig 1 Supplementary Figure 1: The depletion of BRG1 in HeLa cells has no effect on cell proliferation. Sh- empty vector was used.
High molecular weight hyaluronic acid regulates osteoclast formation by inhibiting receptor activator of NF-κB ligand through Rho kinase  W. Ariyoshi,
Rupp et al. Supplementary Figure 1: Structure of the human troponin T gene Exon 6 Genomic DNA cDNA from mRNA mutation Exon 9 Exon bp Parts of genomic.
B A P-AXL P-AXL AXL AXL P-MET P-MET MET MET P-Akt-473 P-Akt-473 AKT
Real time PCR data MMP MCF-7 RNA MCF-7 +
From: PTX3 Controls Activation of Matrix Metalloproteinase 1 and Apoptosis in Conjunctivochalasis Fibroblasts Invest. Ophthalmol. Vis. Sci ;53(7):
Online Data Supplement
Skin Pharmacol Physiol 2017;30: DOI: /
Volume 131, Issue 4, Pages (October 2006)
Overexpression of PAI‐1 reverses the arsenite‐mediated effect on senescence Overexpression of PAI‐1 reverses the arsenite‐mediated effect on senescence.
A B C MDA-MB-231 OHT: h FOXM1 PLK CDC25b ERα Tubulin
A B Supplementary figure S3 ShCtl ShLCoR LCoR mRNA (%) Optical density
High molecular weight hyaluronic acid regulates osteoclast formation by inhibiting receptor activator of NF-κB ligand through Rho kinase  W. Ariyoshi,
A B C Liao et al. Supplementary Figure 1
Expression of adenylyl cyclases and miR‐142‐3p in CD4+CD25− T cells and CD4+CD25+ regulatory T cells. Expression of adenylyl cyclases and miR‐142‐3p in.
Dysregulated circadian rhythm pathway in human osteoarthritis: NR1D1 and BMAL1 suppression alters TGF-β signaling in chondrocytes  R. Akagi, Y. Akatsu,
Supplementary Table 1 Sequences of the primer used for q-PCR analysis
Volume 137, Issue 2, Pages (August 2009)
Teruaki Fujishita, Masahiro Aoki, Makoto M. Taketo  Gastroenterology 
Restriction of spontaneous and prednisolone-induced leptin production to dedifferentiated state in human hip OA chondrocytes: role of Smad1 and β-catenin.
Volume 131, Issue 4, Pages (October 2006)
Volume 136, Issue 2, Pages (February 2009)
Dihydromyricetin decreases the sphere formation through downregulation of Sox2 in human osteosarcoma. Dihydromyricetin decreases the sphere formation through.
Increased connexin43 expression in human saphenous veins in culture is associated with intimal hyperplasia  Sébastien Déglise, MD, David Martin, MS, Hervé.
Volume 22, Issue 4, Pages (April 2014)
MYO5A Gene Is a Target of MITF in Melanocytes
Expression and regulation of Toll-like receptor 2 by IL-1β and fibronectin fragments in human articular chondrocytes  S.-L. Su, M.S., C.-D. Tsai, Ph.D.,
The upstream region of MUC5AC bound by SPDEF is required for the expression of MUC5AC in human lung cancer cells The upstream region of MUC5AC bound by.
Aromatase Inhibitor Exemestane has Antiproliferative Effects on Human Mesothelioma Cells  Daniela Stoppoloni, BSc, Luisa Salvatori, BSc, Annamaria Biroccio,
Involvement of Gas7 along the ERK1/2 MAP kinase and SOX9 pathway in chondrogenesis of human marrow-derived mesenchymal stem cells  Y. Chang, M.D., S.W.N.
Volume 129, Issue 5, Pages (November 2005)
MUC1 Oncoprotein Stabilizes and Activates Estrogen Receptor α
Consequences of reducing SF3B2 expression.
Volume 15, Issue 1, Pages (January 2007)
Supplementary Figure 1. Structure of amlexanox
MUC1 Oncoprotein Stabilizes and Activates Estrogen Receptor α
Fold Change of hsa-miR-3687 (T/N)(log2)
Pituitary Tumor-Transforming Gene 1 Enhances Proliferation and Suppresses Early Differentiation of Keratinocytes  Yosuke Ishitsuka, Yasuhiro Kawachi,
W. Wang, T. Hayami, S. Kapila  Osteoarthritis and Cartilage 
Andrew T Miller, Heather M Wilcox, Zhongbin Lai, Leslie J Berg 
Mechanism of piperlongumine induced Sp downregulation.
Direct effects of dexamethasone on human podocytes
The p53 pathway is involved in the inhibition of cell proliferation observed in 15-LOX-1-overexpressing cells. The p53 pathway is involved in the inhibition.
A: Gene expression of β-myosin heavy chain (hypertrophic marker) was analyzed on real-time PCR and normalized against 18S expression. n = 8–11 for each.
Figure 4. MicroRNA (miR)-195 and miR-497 directly targets CD274
Representative Western blot analyses of S-phase and other proteins from PC3 cell lysates obtained 3 days after oligomer (400 nm)/Lipofectin (15 μg/ml)
Volume 2, Issue 3, Pages (September 2012)
Volume 2, Issue 4, Pages (October 2012)
ALDH1A3 is mainly responsible for the ALDH activity in two human cholangiocarcinoma lines. ALDH1A3 is mainly responsible for the ALDH activity in two human.
Expression of CRC stem cell markers and L1 in CRC cells.
VC KX-01 Total Src p-Y416 Src Supplementary Figure S1. KX-01 at low dose inhibited phosphorylation of Src in MDA-MB-231 xenografts.
RUNX3 depletion induces cellular senescence and inflammatory cytokine expression in cells undergoing TGFβ-mediated EMT. A, Cells were transfected with.
Enhanced expression of Cap43 gene by nickel in breast cancer cell lines. Enhanced expression of Cap43 gene by nickel in breast cancer cell lines. Expression.
Cell-cycle regulatory proteins were controlled by O-GlcNAc at FOXO3 S284 through MDM2. Cell-cycle regulatory proteins were controlled by O-GlcNAc at FOXO3.
Expression data from genes involved in regulation of transit through the cell cycle in response to treatment with E2 and OHT. A. Expression data from genes.
Fig. 4 Dcr-2 binds to the 3′UTR of Toll mRNA.
A B C Name Sequence TIMP3 promoter
Fig. 2 hTERT induces expression of heat shock protein genes through HSF1 and interacts with Hsp70-1. hTERT induces expression of heat shock protein genes.
Presentation transcript:

Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of migratory structures compared to vector control. Phase contrast image of cultured MCF7/Vec and MCF7/S100A7 cells taken at 10x magnification. Inset image shows the representative zoomed area. Supp Fig 2. S100A7-overexpression in MCF7 cells down-regulate genes which are involved in cancer pathways. Total RNA from MCF7/Vec and MCF7/S100A7 cells were analyzed by Affymetrix Human Genome U133 chip. (A) Gene ontology studies using IPA analysis of microarray data. (B) Heat-map of differentially expressed genes in MCF7/Vec and MCF7/S100A7 cells showing reduced expression of β-catenin/TCF4 pathway genes. Supp Fig 3. Expression of estrogen receptor alpha (ERα) in S100A7-overexpressing and vector control MCF7 and T47D cells. 50 μg cell lysates of MCF7/Vec, MCF7/S100A7, T47D/Vec and T47D/S100A7 cells were subjected to Western blotting with ERα antibody. GAPDH was used as a loading control in all the blots.

2 Supplementary figures GenePrimer sequence GSK3β Forward (5’ GGTCTATCTTAATCTGGTGCTGG 3’) Reverse (5’ TGGATATAGGCTAAACTTCGGAAC 3’) Cyclin D1 Forward (5’ TATTGCGCTGCTACCGTTGA 3’) Reverse (5’ CCAATAGCAGCAAACAATGTGAAA 3’) E-cadherin Forward (5’ AGGCCAAGCAGCAGTACATT 3’) Reverse (5’ ATTCACATCCAGCACATCCA 3’) β-catenin Forward (5’ GCTGGGACCTTGCATAACCTT 3’) Reverse (5’ ATTTTCACCAGGGCAGGAATG 3’) GAPDH Forward (5’ ACCCACTCCTCCACCTTTG 3’) Reverse (5” CTCTTGTGCTCTTGCTGGG 3’) Table 1. List of primers used for Real Time – PCR

3 MCF7/VecMCF7/S100A7 Supp. Fig. 1

4 Supp. Fig. 2. TCF7L2 DVL2 DVL3 APC CCND1 ANAPC5 GSK3β DVL2 AXON1 CTNNB1 ANAPC MCF7/Vec MCF7/S100A7 A B

5 Vec S100A7 MCF7 ER-α GAPDH ER-α GAPDH Vec S100A7 T47D Supp. Fig. 3.