What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...

Slides:

Advertisements

Similar presentations

Chapter 13.3 (Pgs ): Mutations

Advertisements

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring, only to descendant cells)

What is a mutation? A mutation is a permanent change in the sequence of DNA.

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

 The sequences of bases in DNA are like the letters of a coded message… what would happen if a few of those letters changed accidentally, altering the.

Mutations. Change / alteration to the DNA of an organism They may be good, bad or have no effect A plant that can better tolerate the cold (GOOD) A change.

Mutations. WHAT?..... DO YOU SEE- WHAT HE SEES?

MUTATIONS _______________ are changes in the genetic material. MUTATIONS mistakes REMEMBER! Mutations can happen when cells make _____________ in.

Definition: changes to an organism’s DNA sequence.

12.4 Mutations. Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription.

Mutations 3.29 Recall that mutation is a rare, random change in genetic material that can be inherited. 3.31 Understand that many mutations are harmful.

Mutations And their effects. A mutation is…  A permanent change that occurs in a cell’s DNA.

Mutations 13.3.

Mutations Learning Targets: Describe different gene mutations.

Gene Mutations Chapter 11.

Mutations Any change in DNA sequence which is not immediately and properly repaired. If they occur in somatic cells then they are non-inheritable, if in.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

BIOLOGY HONORS MUTATIONS. WHAT IS A MUTATION? A change in DNA Can cause changes in organism Happen randomly Can be beneficial, neutral, or harmful For.

Introduction A mutation is a change in the normal DNA sequence. They are usually neutral, having no effect on the fitness of the organism. Sometimes,

Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.

GENETIC MUTATIONS. DNA and Mutations Mutations are any changes that take place in DNA: Can change the genetic code, and be replicated when forming new.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

1.Most genetic disorders result from a mutation in one gene. a.Mutation: a change in an organism’s genetic material (DNA) 2.A mutated gene produces a.

13.3 Mutations. POINT > Define a gene in simple terms POINT > Define and describe genetic mutations POINT > Distinguish between gene and chromosomal mutations.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Unit 6 Notes: Mutations. DNA Mutations Mutations: Any change in the sequence of nitrogenous bases of DNA. Causes: – Mutagens = factors that change chemical.

Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.

Protein synthesis continued.  Transcription is step 1  DNA  mRNA  Nucleus  RNA polymerase.

4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.

BIOLOGY FALL 2014 MUTATIONS. WHAT ARE MUTATIONS? Mutations = changes in the genetic material Mutations can happen when cells make mistakes in copying.

What is a mutation? A mutation is a permanent change in the sequence of DNA.

Mutations 13.3.

12-4 Mutations Baker Block 1 Pgs

Big Q: What are mutations? Big Q: How do mutations affect genes?

Gene Mutations Chapter 11.

Copyright Pearson Prentice Hall

What happens when things go wrong?

Gene Mutations.

Mutations TSW identify and describe the various types of mutations and their effects.

Chapter 12.4 Mutations.

Mutation and Genetic Change

MUTATIONS 12-4.

Kinds of Mutations Point Mutation Occur at a single point in the DNA

April 21, 2011 Why is DNA double stranded?

Mutations Section 12-4.

Given a DNA strand ACTTCA, what is the mRNA strand?

Human Genetic Disorders

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

Topic #3: Types of Mutations

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

DNA: The Blueprints For Life

Mutation, Natural Selection, and Artificial Selection

MUTATIONS 12-4.

Genetic Mutations.

Mutations: Changes in Genes

Presentation transcript:

What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...

1. Substitution: one base is switched for another

2. Insertion: an extra base is inserted (put into) the DNA sequence

3. Deletion: a base is removed from the DNA sequence

Insertions and deletions are called frame shift mutations because they can cause a shift in the grouping of codons changing an entire amino acid sequence.

Chromosomal Mutations change the number or structure of chromosomes. Example: Down Syndrome results from an extra chromosome on pair #21

Genetic Disorders from Mutations Colorblindness Huntington’s disease Cystic Fibrosis Spinabifida Hemophilia Muscular dystrophy Sickle Cell Anemia Turner Syndrome

Significance of Mutations Mutations can be… 1.harmful. –genetic disorders, deformities, death 2.beneficial. –resistance to disease, better camouflage, stronger muscles; important for evolution! 3.neutral. –No effect

What causes mutations? 1.Just happen for multiple reasons, many are unknown 1.Mutagens: external (environmental) triggers that cause gene mutations. –Chemicals (like in cigarettes & asbestos) –Radiation (like x-rays, UV light exposure, & gamma radiation from nuclear energy.) –Viruses