Mutations Changes to DNA. What are Mutations? Any change to the DNA Mutations in body (somatic) cells can cause cell death or cancer Those in germ (sex)

Slides:

Advertisements

Similar presentations

Human Genetic Mutations

Advertisements

Lesson Overview 13.3 Mutations.

DNA MUTATIONS Diseases Types Mutagens

Mutations. The picture shows a human genome Karyotype. Look at it carefully and discuss.

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

TOPIC 4: GENETICS. 4.1: Chromosomes, genes, alleles and mutations ★ State that eukaryote chromosomes are made of DNA and proteins. ★ Define gene, allele.

Human Genetic Mutations

Lesson Overview Lesson OverviewMutations Lesson Overview 13.3 Mutations.

 The sequences of bases in DNA are like the letters of a coded message… what would happen if a few of those letters changed accidentally, altering the.

Mutations. What is a mutation? Mutation – A change in the DNA that affects inherited genetic information They may be gene mutations which result from.

Gene action Protein function, and when it all goes wrong!

Mutations Natural and Artificial Mutations. Mutations There are 2 classes of mutations Nucleotide mutations occur when 1-4 nucleotides are altered, added.

Lesson Overview 13.3 Mutations.

Transcription and Translation. If DNA never leaves the nucleus, how can the DNA message get to the site of protein production, the ribosome?

Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,

DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.

Mutations Any change in DNA sequence which is not immediately and properly repaired. If they occur in somatic cells then they are non-inheritable, if in.

Chapter 11.6 Mutations. Definition- Mutation- a change in the DNA nucleotide sequence Mutation- a change in the DNA nucleotide sequence Types of mutations:

NOTES – CH 17, part 2 DNA & MUTATIONS

Regents Biology Mutations Changes to DNA.

DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

Mutations Chapter Types of Mutations The sequence of bases in DNA are like the letters of a coded message or even the letters of a simple alphabet.

Mutation: The Source of Genetic Variation Chapter 11.

Rate of mutations in the Human Genome A study published in Current Biology in 2009, shows that in total, we all carry new mutations in our DNA.

So Mutations!  Any change to the quantity or structure of DNA of an organism is known as a mutation.  Mutations can occur in either somatic cells (body.

MUTATIONS Slide 2MutationsMutations Slide 3Examples of MutationsExamples of Mutations Slide 4How Mutations occurHow Mutations occur Slide 5The Benefit.

1 & 2) Transcription vs. Translation  DNA  mRNA; nucleus  Making a protein; cytoplasm 3) How many tRNA nucleotides form an anticodon? 33.

Mutations Mutations are changes in DNA Mutations are changes in DNA These can occur in: These can occur in: Somatic cells – can cause tumours/cancersSomatic.

GENETIC MUTATIONS What is this picture depicting?.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Human Genetic Mutations. 2 Main Types of Mutations 1.) Chromosomal Mutations 2.) Gene Mutations.

13.3 Mutations KeyQuestions: 1)What are mutations? 2)How do mutations affect genes? The sequence of bases in DNA are like the letters of a coded message.

Name the 4 gene mutations that can occur State the effect of gene mutations on amino acid sequences.

Lesson Overview 13.3 Mutations. THINK ABOUT IT The sequence of bases in DNA are like the letters of a coded message. What would happen if a few of those.

Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.

Protein synthesis continued.  Transcription is step 1  DNA  mRNA  Nucleus  RNA polymerase.

Lesson Overview 13.3 Mutations.

Human Genetic Mutations

Lesson Overview 13.3 Mutations.

Lesson Overview 13.3 Mutations.

Lecture 55 Mutations Ozgur Unal

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Copyright Pearson Prentice Hall

MUTATIONS And their effect.

Mutations (Ch 13.3).

Mutations Changes to DNA

Types of point mutations

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Human Genetic Mutations

DNA and the Genome Key Area 6a & b Mutations.

Mutations Ms MacCormack Fall 2018.

Lesson Overview 13.3 Mutations Objectives:

DNA and the Genome Key Area 6a & b Mutations.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Mutation Three CAUSES: Definition: Is a permanent change in DNA.

Copyright Pearson Prentice Hall

Lesson Overview 13.3 Mutations.

Mutations Changes to DNA

Lesson Overview 13.3 Mutations.

Lesson Overview 13.3 Mutations.

Presentation transcript:

Mutations Changes to DNA

What are Mutations? Any change to the DNA Mutations in body (somatic) cells can cause cell death or cancer Those in germ (sex) cells may be passed on to offspring called mutants. Mutations may be random (occur spontaneously, e.g. during replication), or be induced by mutagens.

Mutagenic Agents = Mutagens 1.Ionising radiation – e.g.: from nuclear reactions Or X-rays DOH!

2. Ultra-violet E.g from sunbathing

Or Tanning salons….. With possible consequences – Mutagens may also be carcinogens!

Radiant Energy – who’s who?

3. Chemical Mutagens Some chemicals can induce mutations, e.g.: Mustard gas Formalin/formaldehyde Nitrous acids – changes cytosine to uracil Benzene And many, many more! Including several in cigarette smoke

Chemical mutagens in the environment may be responsible for mutants such as this six legged frog.

4. Viruses Papilloma Viruses – Most cervical, vulvar and penile cancers are associated with types 16 and 18 Papilloma Viruses Epstein-Barr Virus – implicated in causing Burkitt's lymphoma and other cancers Hepatitis B Virus – implicated in causing liver cancer

More facts about mutations Usually recessive Most are harmful Produce variety in a species, essential for evolution TYPES PPoint (gene) mutations – affect small areas, often one nucleotide CChromosomal (block) mutations – rearrangements of blocks of genes within or between chromosomes GGenomic mutations – change in the number of chromosomes. (Fewer or extra chromosome or sets of them).

And the good news….. DNA repair The cell does have a number of mechanisms that can recognise and repair damaged DNA. These use the double-sided structure of DNA. So long as one side of the chain is intact it can be used to repair the other side. Breaks in the DNA can also be fixed.

Point (gene) mutations Substitutions – one nucleotide replaces another. May have no effect as the same amino acid is coded for. Mis-sense substitutions - a different a.a. is coded for. This may have little effect or a dramatic effect (e.g. sickle cell disease). Nonsense substitutions – a nonsense (stop) codon replaces one coding for an a.a. These produce a shorter polypeptide so are usually harmful

Point (gene) mutations (cont’d) Deletion or insertion of a nucleotide. One or more nucleotides may be added or removed. This may affect one or more amino acids Frame shift mutations – occur if 1 or 2 nucleotides are inserted or deleted –T–They displace all the bases of the genetic message following the mutation, thus changing every codon, resulting in a totally different polypeptide (or shorter chains).

An Analogy Here is a simple message: THEFATCATATETHEBIGRAT Substitutions THEFITCATATETHEBIGRAT THEFATCOTATETHEBOGRAY Deletion THEFTCATATETHEBIGRAT Insertion THEFATCAXTATETHEBIGRAT

A point mutation example - This is normal haemoglobin that carries oxygen in red blood cells.

Sickle Cell Disease Human chromosome number 11 carries a gene that codes for the beta chain of haemoglobin. A point mutation exists which changes the 6th DNA triplet from CTC to CAC This changes the mRNA codon from GAG to GUG

This mutation causes the substitution of the amino acid Glu (glutamic acid) by Val (valine). It is therefore a mis-sense mutation.

The mutant haemoglobin causes some blood cells to change to a sickle shape.

This change may have many effects on a person carrying two copies of the mutant gene

Deletion Mutation Example

Cystic Fibrosis Affects the CFTR gene on chromosome 7 A number of different mutations have been identified as causing this condition but about 70% of sufferers have 3 nucleotides deleted This deletion causes loss of the amino acid phenylalanine located at position 508 in the protein

People who are homozygous for delta F508 mutation tend to have the most severe symptoms of cystic fibrosis due to critical loss of chloride ion transport. This upsets the sodium and chloride ion balance needed to maintain the normal, thin mucus layer that is easily removed by cilia lining the lungs and other organs. The sodium and chloride ion imbalance creates a thick, sticky mucus layer that cannot be removed by cilia and traps bacteria, resulting in chronic infections.